1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
artcher [175]
3 years ago
13

How does extinction affect evolution?

Biology
2 answers:
Delvig [45]3 years ago
5 0
Mass extinctions reduce diversity by killing off specific lineages, and with them any descendant species they might have given rise to. 
Reptile [31]3 years ago
4 0
It stops the evolution]

You might be interested in
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
A man and a woman have three children, all males. What is the probability that their next child will be a girl?.
ikadub [295]

Given what we know, we can confirm that the couple in question has a 50% chance that their next child will be a girl.

<h3>Why are the odds 1/2 ?</h3>

This has to do with the fact that each child that the couple has is an independent event. While it is true that it is unlikely for the same event to occur many times in succession, the previous events do not influence the outcome of the next child.

Therefore, given that a child can be either male or female when born, the couple in question has a perfect 50% chance for their next child to be a girl.

To learn more about probability visit:

brainly.com/question/11234923?referrer=searchResults

5 0
2 years ago
What do cells need to do to make sure full set of dna gets passed to daughter cell
wlad13 [49]

Answer:

The DNA must be copied so there is a full set of DNA to pass on to each daughter cell.

Explanation:

8 0
3 years ago
Pls help!!<br> Where would you have to be to see this view? Explain.
lisov135 [29]
I’m order to see this view you would need to be out of space
5 0
3 years ago
Beyond the organism, what is the correct order of the levels within the environment
Luba_88 [7]

<u>levels of organization </u>

from the smallest units of life to the largest units of the environment :

organelles >>> cells >>> tissues >>> organs >>> organ systems >>> organisms >>> populations >>> communities >>> ecosystems >>> biosphere

8 0
3 years ago
Other questions:
  • 8. Which of the following type of colors gives a sense of
    5·1 answer
  • Farah is learning that some statements on food labels are more reliable than others. "low fat" is which type of claim?
    6·1 answer
  • Dhara was recently in a car accident. her doctor told her that she has frontal lobe damage. how will this damage affect dhara? s
    6·1 answer
  • Some blind cave salamander have eye how might this be evidence that cave salamander evolved from sighted ancestors
    7·2 answers
  • Sociobiology is founded on charles darwin's theory of evolution. <br> a. True <br> b. False
    6·1 answer
  • A certain species of salamander was split into two populations by a wide, dry valley, and the populations began to diverge from
    12·1 answer
  • BRAINLIEST BRAINLIEST
    12·2 answers
  • if a slide has 28 yeast cells in a field of view of 100 x approximately how many yeast cells will be seen when the magnification
    6·1 answer
  • In which of the following is most of the water on earth held? A. rivers B. glaciers C. soil D. the ocean
    8·1 answer
  • Dentro de las Cadenas Tróficas, existen otros tipos de organismos que se alimentan de fuentes derivadas, sea de las Plantas o de
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!