1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PIT_PIT [208]
3 years ago
12

How is dna methylation used in dna repair?

Biology
1 answer:
Cloud [144]3 years ago
7 0
DNA methylation is a process by which methyl groups are added to the DNA molecule. Methylation can change the activity of a DNA segment without changing the sequence. When located in a gene promoter, DNA methylation typically acts to repress gene transcription.
You might be interested in
Which statement best defines micronutrients
Rudik [331]

a chemical element or substance required in trace amounts for the normal growth and development of living organisms.

4 0
3 years ago
What are the 2 structures that are located within the diencephanon
erik [133]

Answer

Two structures located in the diencephalon are hypothalamus and epithalamus

Explanation

The diencephalon of the human brain has four main structures which are the hypothalamus, the thalamus, the epithalamus and the subthalamus. Thalamus structure is at the center of the brain which relays sensory impulses to the cerebral cortex. The hypothalamus regulates the temperature of the body while the epithalamus maintains the circadian rhythms.


7 0
4 years ago
Describe how physical and chemical changes affect mass
AlladinOne [14]

Answer:

Explanation:

Matter can change form through physical and chemical changes, but through any of these changes matter is conserved. The same amount of matter exists before and after the change—none is created or destroyed. This concept is called the Law of Conservation of Mass.

5 0
2 years ago
How does continental drift affect living organisms? check all that apply. view available hint(s) check all that apply. it may ca
Dmitriy789 [7]
The continental drift affects living organisms in that it causes changes in climates which puts selective pressure on organisms, causes changes in habitats, including when large amounts of shallow marine habitat were lost in the formation of Pangea. Additionally continental drift may cause an increase or decrease in competition among different species and also it happens so slowly that it does not affect living organisms
6 0
3 years ago
Read 2 more answers
Some prokaryotes once classified in the domain Bacteria are now classified as
Ugo [173]
D






hope that helped :))
7 0
3 years ago
Other questions:
  • Starting with the atom and ending with the biosphere, record the Levels of Organization found in life.
    5·1 answer
  • How does your body exchange carbon dioxide for oxygen?
    12·1 answer
  • The type of cover letter written in response to a posted job opening
    6·1 answer
  • Ion channel proteins are always A) glycoproteins with oligosaccharide attached B) lipoproteins with lipid attached C) soluble pr
    15·1 answer
  • What is the name of the microorganism that causes bubonic plague? Yersinia pestis Flea Horse Rat
    11·1 answer
  • In a hypothetical situation, a certain species of aphid feeds only on sugar maple trees. In forests of the eastern United States
    15·1 answer
  • Humans have taken some steps to help reverse or control the negative effects of human-led climate change. Which of the following
    13·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Gene therapy can be used to treat disorders that do not have a present cure. <br> true or false?
    8·1 answer
  • I need this question nowwwwww
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!