1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
14

The fact that fish, penguins, and dolphins all have the same basic shape is BEST explained by which of the following?

Biology
2 answers:
NISA [10]3 years ago
6 0

Answer:

I would say it is E.

Explanation:

because fish, penguins, and dolphins are aquatic animals. It can't be A. because if it were vestigial it would be useless. It can't be B even though it does seem like the right answer because the are all aquatic. It can't be C. because it would been that the same species would have the same niche which is not possible. It can't be D. because every organism is evolved from a common ancestor.

kipiarov [429]3 years ago
6 0

Answer:

B) Fish, penguins, and dolphins all faced the same physical constraints during their evolution and converged upon the same body plan

Explanation:

You might be interested in
The key ingredient of an arterial fluid classified as a cosmetic fluid is a(an)?
lesya692 [45]
I believe it’s an active dye?
4 0
3 years ago
Most soils primarily form on what
Nady [450]
You don’t have any options so idk
8 0
3 years ago
Read 2 more answers
What happens to the suns energy for you to use it as energy in your body?
arsen [322]
The suns energy will decrease and your energy will increase!
3 0
3 years ago
The tough membrane that surrounds the shaft of the bone is the​
Alex73 [517]

Answer: periosteum i think that is what it is called not sure but probalbly correct

Explanation:

8 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • Some cancer therapies target telomerase or dna polymerase. Why are these strategies good to treat cancer
    7·1 answer
  • If you are growing a culture of bacteria (150ml) in the incubator, (a) what size flask should you use, and (b) should you cap th
    15·1 answer
  • The loop of henle is a countercurrent exchanger because it creates a concentration gradient rather than simply maintaining it. f
    15·2 answers
  • Please help !!!!!!!!!!!!!!!!!!!!
    13·1 answer
  • How is science different from other branches of knowledge​
    8·2 answers
  • How are the two strands of a dna molecule bonded together to form a double helix?
    8·1 answer
  • Elements can combine to form molecules, like O2 or CO2. Elements combine to form molecules and these elements are joined togethe
    7·2 answers
  • Identify the similarities and differences between the different types of microscopes
    7·1 answer
  • Explain the importance of fossils and how they provide evidence for evolution.
    5·1 answer
  • Where in the body does osmosis happen?<br><br>​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!