1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ohaa [14]
3 years ago
10

The diagram is a model of one way that materials move

Biology
1 answer:
hram777 [196]3 years ago
8 0

Answer:

they move to an area with lower concentration.

Explanation:

Air particles always travel from an area where they are high in concentration to an area where they are low in concentration. as we can see that on the left hand side the numbers of o2 and co2 molecules are balanced.

You might be interested in
First person to Answer gets a Brainliest!!
noname [10]

Answer:

A) Chlorophyll absorbs sunlight energy for photosynthesis. :)

Explanation:

To quote Nat Geo:

"Chlorophyll’s job in a plant is to absorb light—usually sunlight. The energy absorbed from light is transferred to two kinds of energy-storing molecules" :)

6 0
3 years ago
Read 2 more answers
Yesterday I went on a trip to the beach. I saw several different organisms. First I saw a sea sponge. It had a body that was not
-BARSIC- [3]

Answer:

1. Either porifera or asymmetrical

2. Invertebrate

3. filtering

4. Axis

5. I don't know this one, I'm sorry.

6. Exoskeleton

7. Cold-Blooded creature

8. Vertebrate

9. Endoskeleton

10. Warm-blooded animal

Good Luck! Hope I wasn't too late.

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
All of the following human activities have had a negative impact on the planet except
Rudik [331]
It's beach renourishment
4 0
3 years ago
What happens when both alleles are equally recessive?
Aleks [24]
There always has to be a dominant allele

4 0
2 years ago
Read 2 more answers
Other questions:
  • "[...] se caracteriza por tiques motores e vocais. Os tiques ocorrem várias vezes por dia podendo ser simultâneos ou em diferent
    13·1 answer
  • Which scientist do was responsible for disproving the theory of spontaneous generation
    12·2 answers
  • Your lab group is experimenting with the diffusion of molecules across a membrane. Dialysis tubing is used as a model cell membr
    7·2 answers
  • 17. When a predator is out-competed for biotic resources (prey) by other beller-
    11·1 answer
  • In transcription, if there is an Adenine Nucleotide in the DNA strand then which nucleotide is in the mRNA strand??
    13·1 answer
  • If two species eat a different diet but one of the food sources is eliminated and both species are forced to eat the same foods,
    7·1 answer
  • Sexual reproduces offspring that are genetically ___ to the parent.
    12·1 answer
  • Theo mixes cake batter and places it in the oven at 350°F for 45 minutes. Explain what type of reaction baking a cake represents
    6·2 answers
  • What is the role of RuBP? How is RuBP regenerated?
    6·1 answer
  • Which of the following is not a type of scientific model?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!