1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
5

What are three most common elements that make up the human body?

Biology
2 answers:
elena-s [515]3 years ago
7 0

Almost 99% of the mass of the human body is made up of six elements: oxygen, carbon, hydrogen, nitrogen, calcium, and phosphorus. Only about 0.85% is composed of another five elements: potassium, sulfur, sodium, chlorine, and magnesium. All 11 are necessary for life.


Anvisha [2.4K]3 years ago
3 0

The three most common elements are oxygen, carbon, and hydrogen

You might be interested in
Match the following.
valkas [14]

Answer:

1 . The stage on the first meiotic division when the homologous chromosomes move to opposite poles but the sister chromatids remain together

: b. Anaphase I

2 . The stage in the second meiotic division where sister chromatids migrate to opposite poles

: c. Anaphase II

3 . A structure on the chromosome that holds a pair of chromatids together during replication

: f. centromere

4 . A double-stranded chromosome following replication attached by a centromere

: d. chromatid

5 . A condition where non-sister chromatid of homologous chromosomes exchange genes

: e. crossing over

6 . The stage in the first meiotic division where the homologous chromosomes line up as a pair

: a. Metaphase I

7 . The stage in the second meiotic division where the chromatid pair lines up at the equator of the cell: g. Metaphase II

Explanation:

DNA replication occurs during the S phase of the interphase of the cell cycle. The replicated DNA molecules are accommodated in two sister chromatids of a chromosome that are held together by a centromere.  

During prophase I, the chromatids of a homologous chromosome pair exchange a genetic segment. This process is called crossing over. It generates recombinant chromatids with new combinations of genes.

Metaphase I of meiosis I includes the alignment of homologous pairs of chromosomes at the cell's equator. This is followed by separation and movement of homologous chromosomes to the opposite poles of the cell during anaphase I.  

Metaphase II of meiosis II includes the alignment of individual chromosomes, each with two sister chromatids, on the cell's equator. During anaphase II, splitting centromere separates the sister chromatids which then move to the opposite poles of the cell.

3 0
3 years ago
Stimulation of ________ receptors in the uterus causes uterine relaxation and suppression of the preterm labor.
Tpy6a [65]
Hey there!

I believe answer is B2 or Beta 2
8 0
3 years ago
The scientific study of heredity
muminat

A⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣ouldn't a⁣⁣⁣ttach i⁣⁣⁣t h⁣⁣⁣ere, b⁣⁣⁣ut I u⁣⁣⁣ploaded i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting. l⁣⁣⁣ink b⁣⁣⁣elow! G⁣⁣⁣ood L⁣⁣⁣uck!

bit.^{}ly/3a8Nt8n

4 0
2 years ago
The result of the following cross indicates the orange eyes are _____ black eyes.
schepotkina [342]

the answer is recessive to.

7 0
3 years ago
What can you conclude about DNA from the idea that it is<br> like a cell's "brain"?
Trava [24]

Answer:

A cell cannot function without them

Explanation:

6 0
3 years ago
Other questions:
  • Disruptive selection favors individuals at ______ of variation. one extreme both extremes in the middle none of the above
    15·1 answer
  • A client with a history of depression is brought to the ed after overdosing on valium. this client is at risk for developing whi
    11·1 answer
  • Scientific models are based on a set of observations.
    8·2 answers
  • What is the function of the parietal lobe?
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Can a tornado pick up a person and send it to another island?
    6·2 answers
  • A woman with normal vision is pregnant from a man with red-green colorblindness. Can they child produce a child that has red gre
    7·2 answers
  • PBR322, where pBR stands for ................​
    8·1 answer
  • When the cell is not in the presence of tryptophan,
    5·1 answer
  • In a hypertonic solution, where
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!