1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slega [8]
2 years ago
13

2. Reproduction is the function of both______ and organisms.

Biology
1 answer:
Tems11 [23]2 years ago
4 0

Reproduction is the function of both living <u>plants</u> and organisms.

<h3>What is reproduction?</h3>

Reproduction can be defined as a biological process through which all living organisms (parents) produce their offspring, especially through mating.

<h3>The types of reproduction</h3>

Basically, there are two (2) main types of reproduction and these include;

  • Ase-xual reproduction
  • Se-xual reproduction

Generally, reproduction is one of the main characteristics of a living organism and plants.

In conclusion, reproduction is a function that is peculiar to both living <u>plants</u> and organisms.

Read more on reproduction here: brainly.com/question/2538465

You might be interested in
What does a new cell need to function?
castortr0y [4]

Answer:

Food?

i need 20 more characters so..

6 0
3 years ago
Read 2 more answers
A toy robot can walk,talk because of batteries. What type of energy is stored in the batteries
BartSMP [9]
Chemical energy is stored in the battery cells and converted to electrical energy when it's needed by the toy robot
3 0
3 years ago
Read 2 more answers
There are ___________ pair of true ribs.
Bad White [126]

Answer:

7

Explanation:

There are 12 total pairs of ribs. 1-7 are attached directly to the sternum by costal cartilages, making them true pairs. 8-10 are fake pairs, which means they're attached indirectly to the sternum. And 11 and 12 and free floating ribs, meaning they aren't attached.

5 0
3 years ago
Read 2 more answers
5. A moth has two alleles for spots. It can have brown or white spots. The white allele is recessive and
WARRIOR [948]

Answer:

0.7.5

Explanation:

I hope this is right

3 0
3 years ago
What factors might limit the growth of a goldfish living in a large pond?
Temka [501]

Answer:

Predators, food chain, fights with males, toxic water, contamination, plastic

Explanation:

5 0
3 years ago
Other questions:
  • Certain traits become more or less common in a population as a result of differential reproductive success. which of the followi
    11·1 answer
  • Transportation and urban planners design bus routes. true or false
    12·2 answers
  • The role of a catalyst in a chemical reaction is to
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which statement(s) corresponds correctly to a mutation?
    8·1 answer
  • What you would look for to tell whether a cell was prokaryotic or eukaryotic. Be specific.
    6·1 answer
  • Jacinta realizes she is starting to lose her battle with lung cancer. she keeps praying, "i just want to live long enough to see
    11·1 answer
  • The cell will enter the G1 phase. During this phase, proteins and nucleotides needed for DNA replication will be produced. Also,
    7·1 answer
  • How do the nutrients in soil cause problems when erosion relocates the soil to ponds or lakes?
    11·2 answers
  • What would most likely be the effect if an experimental design specifies only an experimental group?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!