1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
4 years ago
6

Non renewable resources can be replaced ________.

Biology
1 answer:
FinnZ [79.3K]4 years ago
8 0
1: I would say C
2: B 
3: C
You might be interested in
Evolution is a process of ____
kirill [66]

Answer:

Evolution is a process of change in a population through genetic variation over time Evolution involves change over time and descents from common ancestor

3 0
3 years ago
Read 2 more answers
Describe three differences in the organelles of plant and animal cells.
Igoryamba

Answer:

structures include chloroplasts, the cell wall, and vacuoles.

Explanation:

because one has it and the other dose not

5 0
3 years ago
Some diseases are caused by bacteria, protists, invertebrates or viruses. How do diseases caused by bacteria and diseases caused
MrRa [10]
It’s C. Antibiotics is basically a dormant Bacterial cell. So the body has memory cells only for bacteria’s and not viruses
8 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
I'm the lion king what role do the antelope play
kondor19780726 [428]
What happened is jealousy can ruin a family and everything,a brother was jealous of his own brother because he was powerful,caring and every body loved him, so he tried to do anything to kill him, and he lied to him and told him your son is in trouble and it end up having him killed and he told everybody his son killed him.
3 0
3 years ago
Other questions:
  • Which of the following would be the MOST dangerous consequence if humans depleted the world’s timber supply?
    8·1 answer
  • What is the best definition of a eukaryotic cell? has an internal structure consisting of a membrane–bound nucleus and membrane–
    11·1 answer
  • The synthesis of an amino acid follows this pathway: precursor A → intermediate B → amino acid C. Each reaction is catalyzed by
    9·1 answer
  • What is the main function of the ozone layer?​ a. ​to provide cloud cover for protection of polar regions b. ​to block most of t
    7·1 answer
  • Explain the interaction between proteins and nucleic acids.
    15·1 answer
  • What is one positive thing that can happen after a hurricane?
    10·2 answers
  • Locations that are at the Equator have a coordinate of:
    10·1 answer
  • If one half of the DNA ladder is above sequence, what is the other side of the ladder’s DNA sequence?
    5·1 answer
  • Can you help me 20 points!!!
    11·1 answer
  • At some point in their life cycle, all cells have a _____, whereas not all cells have a(n) _____.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!