Answer:
Evolution is a process of change in a population through genetic variation over time Evolution involves change over time and descents from common ancestor
Answer:
structures include chloroplasts, the cell wall, and vacuoles.
Explanation:
because one has it and the other dose not
It’s C. Antibiotics is basically a dormant Bacterial cell. So the body has memory cells only for bacteria’s and not viruses
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
What happened is jealousy can ruin a family and everything,a brother was jealous of his own brother because he was powerful,caring and every body loved him, so he tried to do anything to kill him, and he lied to him and told him your son is in trouble and it end up having him killed and he told everybody his son killed him.
