1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesnalui [34]
3 years ago
5

The equation of the line that has a slope of 2/3 and goes through the point (-6,6)

Mathematics
1 answer:
weqwewe [10]3 years ago
7 0
Y=2/3x+10 - use slope intercept form
You might be interested in
f(x)= x^2 - 2x find the following: f(6)=[ ], f(-3)=[ ], and finally, find f(-4)=[ ] thank you.
GREYUIT [131]

Answer:

f(6) =6^2 - 2(6)

f(6) = 36 - 12

f(6) = 24

f(-3) = (-3)^2 - 2(-3)

f(-3) = 9+6

f(-3) = 15

f(-4) = (-4)^2 - 2(-4)

f(-4) = 16 + 8

f(-4) = 24

Step-by-step explanation:


6 0
3 years ago
10x^3+40x^2+15x<br>------------------------------<br> 5x<br>​
Anna71 [15]

Answer:

Step-by-step explanation:

\dfrac{10x^3 + 40x^2 + 15x}{5x}\\ \dfrac{10x^3}{5x} +\dfrac{40x^2}{5x}+\dfrac{15x}{5x}

2x^2 + 8x + 3 is your final answer.

4 0
3 years ago
What’s the value of DCB?<br> Pls help
amm1812

Answer:

78

Step-by-step explanation:

angle ACD + angle DCB = 180   (Angles on straight line)

4x + 2 + 3x + 3 = 180

7x + 5 = 180

7x = 180-5

7x = 175

x = 175 / 7

x = 25

angle DCB = 3x +3 = 3*25 + 3 = 75 +3 = 78

6 0
2 years ago
Find x.<br><br><br><br> 1.5<br> 2<br> <img src="https://tex.z-dn.net/?f=%5Csqrt%7B3%7D" id="TexFormula1" title="\sqrt{3}" alt="\
Vanyuwa [196]

Answer:

1.5

Step-by-step explanation:

3 0
3 years ago
Mr. Johnston spends 2/3 of every year in Florida how many months does he spend in Florida each year
musickatia [10]

Answer:

8 months

Step-by-step explanation:

12/3 = 4, 1/3 is 4 so 1/3 + 1/3 = 2/3 or 8

6 0
2 years ago
Other questions:
  • What is 63 x 38. how to multiply?
    7·2 answers
  • If an object is dropped from a height of 200 feet, the function h(t) = -16t^2 + 200 gives the height of the object after t secon
    13·2 answers
  • Circle O has a circumference of 36pi cm
    10·1 answer
  • Flip a coin and toss a 1-6 number cube. Probability of: (heads and not a 3)
    14·1 answer
  • Sebastian compro dos alfajores de $ 2,65 cada uno y un chocolate. Si pago con $ 20 y le dieron $ 6,25 de regreso, ¿cuánto cuesta
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Christian has six grades from test and IXL. They are all weighted equally. If Christian's grades are 100,96,96,88,70, and 100, w
    14·1 answer
  • Find the value of x for this shape
    8·1 answer
  • Solve for indicated side<br><br> Your Answer:<br> Question 4 options:<br> Answer
    6·1 answer
  • Combine the radicals 4√7+3√28.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!