1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kupik [55]
3 years ago
12

How does surface area change with size and why is it important?

Biology
1 answer:
timurjin [86]3 years ago
6 0
Well the surface area changes because there are two dimensional which are flat    and 3-d which would be geometric. It is important because if you have to take volume or area you would know why there 2-d and 3-d are important.


hope that helped
You might be interested in
Lotions applied during winter season moisturize the skin very quickly. What could be the reason for this?
MrRissso [65]

The right answer is D.

The absorption of molecules at the level of the skin is carried out by passive diffusion for the molecules of low molecular weight (lower than 400 Da), the skin being covered with a lipoprotein film rich in water by its stratum corneum, rendering it little-permeable.

This absorption may be variable according to factors related to the skin such as stratum corneum's thickness, the state of hydration, the presence of cutaneous lesions or individual variations.

External factors may also modulate percutaneous absorption such as contact time, iontophoresis or the presence of specific adjuvants.

8 0
3 years ago
What is a “spill-over” infection
Sav [38]

Explanation:

Spillover infection, also known as pathogen spillover and spillover event, occurs when a reservoir population with a high pathogen prevalence comes into contact with a novel host population. The pathogen is transmitted from the reservoir population and may or may not be transmitted within the host population.

3 0
3 years ago
Give the function of all of the following parts of a typical flower. a. Petals
maxonik [38]

A.Petals. Usually, petals are the most prominent part of a flower structure, owing to their vivid color (in most flower examples) and sometimes scent. Their main function is to attract pollinators and also protect the inner reproductive structures of a flower. In some flowers, petals are absent or reduced.

B.Stamen: The pollen producing part of a flower, usually with a slender filament supporting the anther. Anther: The part of the stamen where pollen is produced. Pistil: The ovule producing part of a flower. The ovary often supports a long style, topped by a stigma.

C.Pistil interaction precedes fertilization in the flower. Important changes occur in the pistil, which play a role supporting, but also controlling pollen-tube growth

D. The ovule is the organ that forms the seeds of flowering plants. It is borne in the ovary of the flower and consists of nucellus protected by integuments, precursors of embryo/endosperm, and seed coat, respectively.

4 0
3 years ago
Explain how hydrological conditions in Florida, such as the depletion of aquifers influences the landscape (sinkholes), and indi
Naddik [55]
Water had the capability to hold up the thin overhang of the underground.

When water is depleted, there is nothing to support this overhang, which eventually led to the formation of sinkholes.

As for the collective behavior, it's all because of the scarcity. Water is one of human's basic needs to survive. When water is scarce, this will force the people to compete with one another to obtain it, which will cause the behavior
3 0
3 years ago
Which best describes the types of organisms found in estuaries?
kumpel [21]
The answer to this question is : <span>They tolerate both freshwater and salt water.</span>
8 0
3 years ago
Other questions:
  • The Kingdom Monera has been separated into two domains, the Archaea and the Bacteria. Which of the following was most important
    7·2 answers
  • Which of the following is NOT a function of proteins?
    14·1 answer
  • Which is the best fluid source for casual exercisers to replace lost body fluids? a. Glucose solution b. Fruit juice c. Salt sol
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What do we mean when we refer to a cell as differentiated?
    6·1 answer
  • Which animal is the most intelligence
    11·1 answer
  • Why does ice float on liquid water
    10·2 answers
  • ATP synthase is powered or driven by ______ flowing through it, in order to make ATP molecules.
    15·1 answer
  • 15. Which of the following are considered sources of "Chemical
    9·1 answer
  • How is science different from other ways of learning about the world?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!