Human blood type is controlled by three alleles (A B. O). O is recessive and A and B

Biology

1 answer:

PolarNik [594]4 years ago

6 0

Answer: Yes, it is possible that this student's parents are both the true biological parents.

Their genotype must be heterozygous for the blood type A (AO).

Explanation: Each blood type is controlled by two alleles. A and B are dominant while O is recessive. For two parents that have blood type A to have a child with a blood type O, the both of them are heterozygous for blood type A, this means that each of them has one A dominant allele and one O recessive allele. Their genotype can be represented as AO. The child with blood type O is inherited one O recessive allele from each parent, that is she is homozygous for the blood type O. AO x AO = AA, AO, AO and OO.

AA and AO will manifest as blood type A while OO will manifest as blood type O.

See the attached punnet square for more information.

You might be interested in

Draw and label nucleus, mitochondria, smooth er, rough er, lysosome, nucleolus, ribosome, chloroplast, central vacuole, vesicles

Vsevolod [243]

Nucleus is the main component of the cell and carries out the vital processes of the cell.

For learning about its structure, a nucleus diagram is quite helpful. Important components of its structure include.
One feature of the nucleus that distinguishes eukaryotic cells from prokaryotic ones is the nuclear membrane.
Additionally, it has a double-layer structure. It also has phospholipids in it.
The nuclear envelope, nucleoplasm, or nucleus sap, nuclear matrix, chromatin, and nucleolus are some of the several structures that make up the nucleus.
The nuclear membrane, also referred to as the nuclear envelope, creates an envelope-like structure surrounding the nuclear contents.

learn more about Nucleus here:

brainly.com/question/804369

#SPJ4

4 0

2 years ago

Help I'm confused!

aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0

3 years ago

Why did Charles Darwin predict that tetrapods evolved from fish?

qwelly [4]

Answer:

fish and tetrapods are both vertebrates that have a backbone with a spinal cord. fish lived before tetrapods because their fossils are in rocks over 500 million years old.

Explanation:

fish and tetrapods are both vertebrates that have a backbone with a spinal cord

8 0

2 years ago

Some people say it is not a good idea to eat a large meal after exercising or before you go to bed. Explain why this could be th

Nataliya [291]

Because you slow down so your metabolism stops

6 0

3 years ago

Stitching of the large tissue that acts as a tendon and attaches muscles to bone is called what?

Helen [10]

If it's not a tendon, then I'm pretty sure it's a ligament.