1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
schepotkina [342]
3 years ago
5

In an organ transplant, a doctor transfers a donated organ from a recently deceased person to a live patient. One of the consequ

ences is that the patient’s immune system—the system that protects against diseases and pathogens in the body—will reject the new organ. Explain why this consequence isn’t a concern with organs grown from human stem cells.
Biology
2 answers:
Aleksandr-060686 [28]3 years ago
7 0

Answer:

i was just about to say that ha

Explanation:

lina2011 [118]3 years ago
5 0
Human stem cells haven’t specialized in to create an organ. This means that they can be manipulated to create a variety of organs for organ transplant and therefore lowers the risk of rejection
You might be interested in
Resource partitioning results in: a move from the realized niche to the fundamental niche for both species. individuals of each
bazaltina [42]

Answer:

a move from the fundamental niche to the realized niche for both species.

Explanation:

The niche of an organism is the functional role of the organism in the community or the ecosystem as a whole. This include the environment an organism lives and all the jobs it does in it.

Fundamental niche refers to all the possible functional roles of an organism in an ecosystem while realized niche refers to the specific roles the organism is limited to as a result of resource limitation, competition or other factors.

Resource partitioning involves the division of limited resources among organisms so as to avoid competition within the niche.

<em>Hence, resource partitioning causes a move from the fundamental niche of an organism to the realized  niche of that organism. </em>

7 0
3 years ago
The functional units of kidneys where blood is filtered and urine produced are called the functional units of kidneys where bloo
Reika [66]
The correct answer is nephron.
<span>
The nephron consists of Bowman’s capsule ( where blood is initially filtered ) and glomerulus which is a tuft of capillaries. Bowman’s capsule and a glomerulus together form the renal corpuscle. The renal tubule extends from the capsule and it consists of proximal convoluted tubule (selective reabsorption), a loop of Henle (establishes a salt gradient) and distal convoluted tubule (selective reabsorption). </span>
3 0
3 years ago
Explain the mechanism by which air masses rise and fall and how it contributes to stratospheric ozone deterioration
Bogdan [553]
<span>Air masses rise and sink due to the fact that warm air is lighter than cold air , thus warm air rises and cold air then sinks. When air masses rise, gaseous molecules are transported into the atmosphere which negatively impacts the ozone layer.</span>
8 0
3 years ago
In hogs, a dominant allele B results in a white belt around the body. At a separate locus, the dominant allele S causes fusion o
GREYUIT [131]

Answer:

D) B/b;S/s (x) b/b;s/s

Explanation:

Parent 1 : belted syndactylous sow

Since it is showing dominant phenotype for both the traits, it can either be BBSS or BbSs

Parent 2: unbelted cloven-hoofed

Since it is showing recessive phenotype for both the traits, it can only have bbss genotype

If we assume parent 1 to be BBSS all the resulting progeny with bbss will have dominant phenotype which is not the case.

If we assume parent 1 to be BbSs:

BbSs X bbss =

BbSs : belted syndactylous

bbSs : unbelted syndactylous

Bbss : belted cloven

bbss : unbelted cloven

The progeny will be produced in 1:1:1:1 ratio which means that each of them will make 25% of the population.

Hence, parent 1 will have BbSs genotype and parent 2 will have bbss genotype

7 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Other questions:
  • The chemical found in plants that gives it the ability to undergo photosynthesis is:
    14·2 answers
  • You find that the canaliculi of the bones are very underdeveloped based on this finding you diagnose that the patient is weak bo
    15·1 answer
  • Question 9.9. Which bone would a forensic anthropologist analyze to identify a victim as male or female?
    7·2 answers
  • Which word best describes the structure of the cell membrane? A rigid b layered c impermeable d nonpolar?
    5·1 answer
  • Some steps in mitosis are shown below. They are not in order.
    14·2 answers
  • What 2 properties of water make capillary action possible?
    8·1 answer
  • Which of the following instruments produces highly magnified images of a cell’s internal structure but cannot be used to examine
    13·1 answer
  • Analogy: An enzyme's active site is to a specific substrate as a _______________ is to a ______________.
    11·1 answer
  • For you who who like brainly
    8·2 answers
  • How many millimetres (equivalent depth) of water are
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!