1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
14

What technological tools allow scientists to study bacteria?

Biology
2 answers:
Wittaler [7]3 years ago
8 0
What technological tools allow scientists to study bacteria? Microscopes
Alekssandra [29.7K]3 years ago
3 0
Microscope. hope it helps
You might be interested in
What animals that grow naturally in the Pacific Northwest and Kitsap Peninsula ? please help
Luba_88 [7]

Answer: Pacific Northwest Animals & Birds

  1. Spotted and snowy owls.
  2. Bald and Golden eagles.
  3. Pileated woodpecker.
  4. Rufous hummingbird.
  5. Great Blue Heron and Canada goose.
  6. Seabirds, including cormorant.
  7. Bear.
  8. Olympic marmot.

Kitsap Peninsula:

Marine mammals of the sound include orcas, sea lions, sea otters, gray whales, humpback whales, and harbor seals. Underwater plants provide food, breeding areas, nurseries, and resting places for wildlife in the sound.

3 0
3 years ago
1. If salt dissolves well in water, you would say it is _______ and ________.
pav-90 [236]

Answer:

1. soluble and

2. hydrogen bond and

3. cohesion

i hope this helps

3 0
3 years ago
How can a branching diagram which plants produce seeds
Elis [28]

Answer:

These seed plants fall into two groups, angiosperms and gymnosperms. Angiosperms are the flowering plants. Their seeds develop inside a female reproductive part of the flower, called the ovary, which usually ripens into a protective FRUIT.

Explanation:

5 0
3 years ago
What modifies and transports proteins?
Alexandra [31]

<u>Answer:</u> The Golgi apparatus is found close to the nucleus of the cell, where it modifies proteins that have been delivered in transport vesicles from the RER. It is also involved in the transport of lipids around the cell. Pieces of the Golgi membrane pinch off to form vesicles that transport molecules around the cell.

8 0
3 years ago
Read 2 more answers
What happens as waves travel and objects in their path move?
Elena-2011 [213]

Answer:

I think answer is

-the waves transfer energy

7 0
3 years ago
Other questions:
  • The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.
    13·1 answer
  • The process of. Is where autotrophs convert solar energy into high-energy sugars and starches.
    10·1 answer
  • Scientist have developed the atomic theory over a period of hundreds of years what will help us further the development
    9·1 answer
  • the purpose of cellular respiration is to store the energy of chemical bonds of glucose in molecules of ________________________
    13·1 answer
  • How do plants reproduce? <br><br> 1. Sexually<br> 2. Asexually
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Using the information in this photo, what can MOST LIKELY be learned about the rocks in the illustration?
    14·1 answer
  • 88 points !!!!!!!!!​
    12·1 answer
  • Lionfish are native to the tropical waters of the Indo-Pacific. What conclusions can be made about the impact of climate change
    9·1 answer
  • To investigate a possible relationship between two factors, such as acidity and solubility, you must first identify the variable
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!