1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
10

Which side of a mountain faces the moist rich ocean air? Plz help

Biology
1 answer:
riadik2000 [5.3K]3 years ago
6 0
I would say down wind side but I'm not 100% sure
You might be interested in
Which of the following substances contained the most catalase?
wlad13 [49]
The Answer is Potato.
8 0
2 years ago
Read 2 more answers
During metaphase, a step in the cell cycle, a cell —
makvit [3.9K]

Answer:

Brainliest

Explanation:

During metaphase, the chromosomes that carry genetic information align in the equator of the cell before they split off into two daughter cells with identical genetic material. Metaphase is the third stage of mitosis, which is a phase of the cell cycle where chromosomes in the nucleus are divided between two cells.

8 0
2 years ago
Is a nucleotide made up of sugar, phosphate and two nitrogen bases
Elza [17]

Answer:

A nucleotide consists of three things: A nitrogenous base, which can be either adenine, guanine, cytosine, or thymine (in the case of RNA, thymine is replaced by uracil). A five-carbon sugar, called deoxyribose because it is lacking an oxygen group on one of its carbons

Explanation:

brainliest plzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz

7 0
3 years ago
What does each parent contributes to their offsprings?
GREYUIT [131]
Chromosomes females have xx and males are xy 
3 0
3 years ago
Which of these go with INNATE immunity? Select ALL correct answers.
aleksandr82 [10.1K]

Answer:The white blood cells involved in innate immunity are. Monocytes (which develop into macrophages). Neutrophils. Eosinophils. Basophils. Natural killer cells.

Explanation: MERK MELLS

6 0
2 years ago
Other questions:
  • How have cactuses adapted to the fact that it almost never rains in the desert?
    15·1 answer
  • Where in your body do you make protein cutting enzyme
    5·1 answer
  • In what frequencies would you expect the offspring genotypes? indicate the frequency of each genotype by dragging the labels to
    14·1 answer
  • Select all that apply. Which of the following are parts of a desert community? jack rabbit plankton beaver cactus crayfish
    9·1 answer
  • 5. Membrane receptors are specialized proteins that take part in communication
    13·2 answers
  • Which property describes a mixture
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of these does the sun provide in large amounts?
    5·2 answers
  • A specific type of bacteria reproduces through binary fission every two hours. If there are seven bacteria to begin with, how ma
    13·2 answers
  • __________ is the situation when one hormone exaggerates the effects of another hormone at the target cell?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!