1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ronch [10]
3 years ago
10

Midlatitude lakes undergo mixing more than equatorial lakes because

Biology
1 answer:
diamong [38]3 years ago
5 0
<em>the correct option is D) all above..</em>
You might be interested in
Will the heart model be able to function properly if the straw is blocked
MArishka [77]
No, your heart model cannot function if the straw is blocked.
6 0
3 years ago
Which scientist likely has the most accurate data?
NeTakaya

B)Gavin, whose data were reproduced by other scientists  

to have the most accurate data, you need to be able to retest your results multiple times and get the same answers. shelly, only copied her data onto several charts, this does not make her answer any more correct. preston, repeated his data but got a different answer, automatically making this answer incorrect. and lilah, only tested her data once. so gavin, is most likely to have the most accurate data, because he tested his results multiple times with other people and they all came up with the same answer.                                Hope this helped :)

8 0
3 years ago
Read 2 more answers
Identify the cellular structures and it’s functions
Eva8 [605]

The cellular structures include cell nucleus, nuclear pores, genetic material (DNA), cytoplasm, nuclear lamina, cell membrane, mitochondria, cytoskeleton and lysosome. It is an animal cell.

<h3>Cellular structures and organelles </h3>

The cellular structures observed in the Figure include cell nucleus (A), nuclear pores (B), genetic material (C), cytoplasm (D), nuclear lamina (E), cell membrane (F), mitochondria (G), cytoskeleton (E) and lysosome (F).

The cell nucleus is an organelle that contains the genetic material (DNA) in eukaryotic cells.

The nuclear pores are little pores in the nuclear membrane that allow the passage of small molecules (e.g., RNAs, transcription factors) by simple diffusion.

The genetic material (DNA) contains the instruction to synthesize all cellular components.

The cytoplasm is an aqueous solution inside the cell, which is mainly composed of dissolved proteins and salts.

The nuclear lamina is a rigid structure located inside the cell nucleus which serves to provide structural support to this organelle.

The cell membrane is a semipermeable lipid bilayer that allows the passage of certain substances in and out of the cell.

The mitochondria are the energetic factories of eukaryotic cells, which act to generate ATP by a process called cellular respiration.

The cytoskeleton is an interconnected network of protein filaments that provides structural support to the cell.

The lysosome is an organelle inside animal cells that contains hydrolytic enzymes used to degrade different substances.

Learn more about cellular components here:

brainly.com/question/6350862

8 0
3 years ago
Which beaks would be best for picking insects out of wood and worms out of sand
Kipish [7]

Answer:

Explanation:

woodpecker???

3 0
3 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
Other questions:
  • What aggressive personality type has been linked to greater risk for high blood pressure and increased secretions of stomach aci
    11·1 answer
  • The bodies of multicellular fungi are composed of chitin. <br> True or False
    11·1 answer
  • g In rabbits, an allele that produces black fur (B) is dominant over its allele for brown fur (b). The allele of another gene (E
    14·1 answer
  • Which of the following descriptions about the different forms of DNA is not correct?
    15·1 answer
  • Cellular respiration takes place in the presence of and with the use of which of the following
    7·1 answer
  • Which of the following groups is made up of organisms that are most similar genetically
    15·1 answer
  • what happened when you simulated wave movements in your oil spill model. what affect would this have on resource availability fo
    12·1 answer
  • Looking at the picture, how does water move into the roots of a plant when there is a high
    10·1 answer
  • NEED NOW <br> Why would I think dogs have unusual cells?
    13·2 answers
  • Check all statements below that are true
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!