1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Burka [1]
3 years ago
5

Why is a rain drop a particularly damaging element to soil?

Biology
2 answers:
UNO [17]3 years ago
4 0

Answer:

Raindrops can cause soil erosion.

Explanation:

When the soil is without vegetation, whether it is alive or dead, if a rain occurs, it is highly vulnerable to erosion. This is due to the kinetic energy (or energy of the falling motion) of the raindrops. Raindrops act by "bombarding" the soil, causing it to disintegrate. As a result, aggregates of soil particles are disrupted by the impact of raindrops and the particles that compose it begin to settle on the soil surface, reducing the pores that absorb water in it.

Thus, with less pores to absorb water, there is a decrease in the rate of water infiltration into the soil, which is more likely to run on the soil surface in a process called runoff that, in tropical regions, is the major cause of erosion. of the soils. This "attack" by raindrops on bare soil causing disintegration of its structure is called splash erosion and the reduction of infiltration due to clogged pores from the soil surface is known as surface sealing due to the formation of surface crusting. .

IgorLugansk [536]3 years ago
3 0

Answer:

It can cause erosion due to the soil dislodging from the rain drops.

Explanation:

You might be interested in
18. Which of the following is anatomical evidence theat two organisms have common ancestors?
Jobisdone [24]

Answer:

organisms have similar bone structure.

Explanation:

please make me brain list answer

4 0
3 years ago
A nurse observes a few small, yellow nodules on the cervix of a client during the speculum exam. They are not painful or odorous
Natalija [7]

Answer:

A nurse observes a few small, yellow nodules on the cervix of a client during the speculum exam. They are not painful or odorous, and a thin, clear discharge is present. The nurse recognizes that these are most indicative of nabothian cysts.

Explanation:

Nabothian cysts or nabothian follicles are also called mucinous retention cysts or epithelial cysts. It is a mucus-filled cyst on the surface of the cervix. Many women have multiple cysts they are common, benign and considered a normal feature of the adult cervix. They may be translucent or opaque, whitish to yellow, and range from a few millimeters to 3 to 4 cm in diameter. They are most often caused when stratified squamous epithelium of the ectocervix  which is the nearest portion to the vagina that grows over the simple columnar epithelium of the endocervix  which is the nearest portion to the uterus.

There are no serious complications or threat to your health with nabothian cysts.

4 0
2 years ago
You throw a ball to win the
Gala2k [10]
The nervous system is sending nerve receptors to your brain so that your arm the muscular system will throw the ball the skeletal system allows yourself to hold the ball and works with the muscles to contract and the amp system allows your body to create energy so you can throw the ball
6 0
2 years ago
_____currents are caused by temperature and density differences. A. Deep B. Longshore C. Tsunami D. Surface
Margarita [4]

Your answer to your Question is ...A: deep

These currents move water masses through the deep ocean—taking nutrients, oxygen, and heat with them. Occasional events also trigger serious currents.

4 0
3 years ago
Plasmid bacteria have been developed to produce insulin, which is used by many diabetes patients. Which group of scientists MOST
blagie [28]
I am pretty sure it is <span>D. Microbiologist</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • I need a testable statement/problem.
    9·1 answer
  • "in order for the stain to penetrate the impervious coat of the spore, which primary stain is steamed into the cell surface?"
    12·1 answer
  • What is true about innate behavior, such as the tendency of bulldogs to want to chase larger animals or cars?
    10·1 answer
  • Why does a caterpillar use captured light energy
    9·1 answer
  • Where does spermatogenesis take place?<br> vas deferens<br> urethra<br> testes<br> penis
    11·2 answers
  • Charles Darwin is known for his revolutionary argument that
    5·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Hey! pls help i’ll give brainliest
    14·2 answers
  • One of the main differences between plants and animals is
    14·1 answer
  • HELP! 30 points plus BRAINLIEST
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!