1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Burka [1]
3 years ago
5

Why is a rain drop a particularly damaging element to soil?

Biology
2 answers:
UNO [17]3 years ago
4 0

Answer:

Raindrops can cause soil erosion.

Explanation:

When the soil is without vegetation, whether it is alive or dead, if a rain occurs, it is highly vulnerable to erosion. This is due to the kinetic energy (or energy of the falling motion) of the raindrops. Raindrops act by "bombarding" the soil, causing it to disintegrate. As a result, aggregates of soil particles are disrupted by the impact of raindrops and the particles that compose it begin to settle on the soil surface, reducing the pores that absorb water in it.

Thus, with less pores to absorb water, there is a decrease in the rate of water infiltration into the soil, which is more likely to run on the soil surface in a process called runoff that, in tropical regions, is the major cause of erosion. of the soils. This "attack" by raindrops on bare soil causing disintegration of its structure is called splash erosion and the reduction of infiltration due to clogged pores from the soil surface is known as surface sealing due to the formation of surface crusting. .

IgorLugansk [536]3 years ago
3 0

Answer:

It can cause erosion due to the soil dislodging from the rain drops.

Explanation:

You might be interested in
The ______ proton is found in the nucleus and represents the element's ____________. A) positive; symbol B) positive; atomic num
Artyom0805 [142]
B, proton is positive and it does not represent the symbol
8 0
3 years ago
Roger has AIDS. He hates hospitals and the antiseptic quality of any institution. He wants to die at home with his family around
Katyanochek1 [597]

Answer:

C

Explanation:

Hospice care is for people who want to die at home with their family, assised living is for people who need some assitance with living, Nursing home care is for long term care usually when patients can't live at home , kailiai is a region

6 0
3 years ago
PLEASE HELP!! 50 POINTS!
artcher [175]
I think the answer is B.
5 0
3 years ago
Let's have a conversation!​
AfilCa [17]

Answer:

I do not understand what you mean

4 0
3 years ago
How many muscle types do mollusca have ? discuss these types? <br>help me
musickatia [10]

Answer:

Mollusks can be segregated into seven classes: Aplacophora, Monoplacophora, Polyplacophora, Bivalvia, Gastropoda, Cephalopoda, and Scaphopoda. These classes are distinguished by, among other criteria, the presence and types of shells they possess.

4 0
3 years ago
Other questions:
  • List two animals or plants that have adaptations that allow them to survive in their environment. What are thoes adaptations? Ho
    5·1 answer
  • A physical property that does not depend on the amount of matter in the substance is A) extensive. B) measurable. C) intensive.
    13·1 answer
  • Insects often act as pollinators for plants. In turn plants provide these insects with food. What kind of a relationship exists
    14·2 answers
  • Of the following muscle types, which has the longest muscle cells and has obvious stripes called striations? Of the following mu
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Is The Following Sentance True Or False: Common Sense was published in Philadelphia in January 1776. Within months, 120,000 copi
    14·1 answer
  • If two organisms are in the same phylum, which other classification category must they also share? A.class B.order C.kingdom
    7·2 answers
  • Which is not a characteristic of amniotic sac
    10·1 answer
  • The transfer of heat is responsible for many of the events that occur on Earth. Which of the following events is most directly c
    11·1 answer
  • henke vg, bateman bt, leffert lr. focused review: spinal anesthesia in severe pre-eclampsia. anesth analg. 2013 sep;117(3):686-9
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!