1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
3 years ago
12

Help me with my science please! :D Will give brainliest, if you answer CORRECTLY

Biology
2 answers:
Soloha48 [4]3 years ago
8 0
<h3>✽ - - - - - - - - - - - - - - - ~Hello There!~ - - - - - - - - - - - - - - - ✽</h3>

➷ 4) Punnet squares are used to predict phenotypes

5) It would be Bb in all of the squares except for the bottom right square  which should have bb

Brown eyes: 3 out of 4 or 75%

Blue eyes: 1 out of 4 or 25%

<h3><u>✽</u></h3>

➶ Hope This Helps You!

➶ Good Luck (:

➶ Have A Great Day ^-^

↬ ʜᴀɴɴᴀʜ ♡

Allushta [10]3 years ago
3 0

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ 4. Punnett Squares are used for predicting the genotype of a cross breeding experiment like Gregor Mendel did with pea plants.

5. Without knowing which allele is blue or brown, you can't solve the percentages but I've attached the Punnett Square filled in below.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

You might be interested in
What's the answer please?
Readme [11.4K]
The awnser is the last one
6 0
3 years ago
Decomposers get energy by breaking down
Vlad [161]

Answer:

waste of other animals,eating dead animals and plants

3 0
2 years ago
Read 2 more answers
FRAP has revealed that some proteins move in cell membranes much slower than they move in reconstituted liposomes. Which of the
Sergio039 [100]

Answer:

e. All could limit protein mobility

Explanation:

Plasma membrane proteins perform a variety of functions: they act preferentially on transport mechanisms, organizing true tunnels that allow substances to pass into and out of the cell, function as membrane receptors, among other functions. These proteins vary greatly in their mobility, some are as mobile as lipids, while others are practically immobile. But FRAP has revealed that some proteins move in cell membranes much more slowly than in reconstituted liposomes. This limited mobility can be explained by the statement in alternative "E" of the above question.

3 0
3 years ago
What does learn by trial and error mean? (
Ilia_Sergeevich [38]
The answer is D: test possible choices and then avoid ones that are not desirable.
3 0
3 years ago
Which statements can be made about mass?
ozzi

Answer:

Weight can be measured in pounds.

A bowling ball has more mass than a basketball.

A bowling ball weighs more than a basketball.

Weight can be measured with a scale.

Objects have the same mass regardless of where they are.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Is the blood pressure measured in the calf larger or smaller than the blood pressure measured on the upper arm?
    12·1 answer
  • An individual whose genotype is AABbCc is crossed with an individual who is heterozygous for all three of these genes. If this c
    12·1 answer
  • Which autonomic nerve innervates the urinary bladder, uterus, and external genitalia?
    11·2 answers
  • Please help answer 3-5
    14·2 answers
  • PLEASE HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    8·1 answer
  • The best treatment for a blister is to pop it, remove the skin covering the blister, and cover it with a bandage.
    5·1 answer
  • In our lives, we rarely experience temperatures that are above 373 K (100 °C) or below 273 K (0 °C). Investigate how much diffus
    15·1 answer
  • (GIVING BRAINLIEST!!)
    9·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which of the following is NOT a resource that organisms fight over for survival?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!