1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
12

Which word means inflammation of the lung?

Biology
2 answers:
sertanlavr [38]3 years ago
8 0

Answer:

pneumonitis

Explanation:

because yes

SashulF [63]3 years ago
5 0

Answer:

could you list out the words bein asked

Explanation:

You might be interested in
For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen
Naddika [18.5K]

Answer:

It's C

Explanation:

Hope this helped :)))

5 0
3 years ago
What is it about a person that could cause ordinarily beneficial traits to become so self-defeating?.
Gala2k [10]

You may have feelings of inadequacy when you can't have—or give your children—the kind of life that others seem to have. All of these situations and challenges can lead to stress, which in turn lead to the development of Self Defeating Behaviors (SBD).

<h3>What is  beneficial traits?</h3>
  • Beneficial traits are extremely varied and may contain anything from protective coloration to the ability to operate a new food source, to a change in size or constitution that might be useful in a certain environment.
  • Over time, these favorable traits become more common in the residents. Through this process of natural preference, favorable characteristics are transmitted through generations. Natural preference can lead to speciation, where one species gives rise to a new and distinctly different species.
  • The artificial section is the identification by humans of seductive traits in factories and animals, and the steps taken to enhance and memorialize those traits in future years.

To learn more about beneficial traits, refer to:

brainly.com/question/26681159

#SPJ4

3 0
1 year ago
Which is true about wool?
Bad White [126]
Its the third answer 

4 0
3 years ago
What is the difference between a unicellular organism and a multicellular organism
VikaD [51]

Answer: A unicellular organism consists of 1 single egg, and a multicelluar organism consists of 2 or more eggs.

Explanation:

5 0
3 years ago
Pathogens are transmitted in only two ways: by direct contact and by vectors.
Marina86 [1]

Answer: False

Explanation:

Pathogens can be transmitted in many ways. It can spread by direct contact, indirect contact, or by vectors.

The mode of transmission can be skin contact, airborne particles, touching a surface, bodily fluids, touched by an infected person.

The mode of transmission can be vector that carries disease and helps in disease transmission.

So, the pathogens can be transmitted by direct contact, indirect contact or by vectors and by many more ways.

4 0
3 years ago
Other questions:
  • Which parts do BOTH animal and plant cells have?
    13·2 answers
  • Six fingered offspring are formed from normal fingered parents
    10·2 answers
  • What is an acid? What is a base?
    11·2 answers
  • According to the diagram, the LEAST amount of water is used in households when people A) wash clothes. B) take showers. C) flush
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The energy transformations are similar because they both involve transformations that
    9·1 answer
  • Culturing of the sputum resulted in the growth of distinct colonies on the medium, and the technician informs you that further i
    7·1 answer
  • What are the three components of a nucleotide
    13·1 answer
  • Which of the following is the reason that kelp live in deep, calm waters?
    5·1 answer
  • Please answer number 4! It’s a do-now!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!