1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
coldgirl [10]
1 year ago
9

This demand curve has shifted. The original demand curve is labeled as D. The new demand curve is labeled as D1.

Biology
1 answer:
Aleksandr-060686 [28]1 year ago
7 0
Send a picture of the graph and then i may be able to help…?
You might be interested in
Why do the phospholipids surrounding the cell form a bilayer?
mezya [45]
<span>A cell is surrounded by water, there is also a lot of water inside.</span>


-The tail go together







8 0
3 years ago
In the food web picture, squirrels would be classified as ? is it
professor190 [17]

Answer:

Omnivore

Explanation:

Squirrels mainly eat fungi, seeds, nuts and fruits, but they will also munch on eggs, small insects, caterpillars, small animals and even young snakes.

6 0
2 years ago
What is the evidence that glaciers once existed on all of the southern continents?
Kitty [74]

Answer:

A.

Explanation:

There is also much climate evidence supporting continental drift, most notable of which is glacial activity. Alfred Wegener investigated this field and found an anomaly in the Permo-Carboniferous ice sheet that was found through glacial till deposits to have once covered all the southern major plates.

3 0
2 years ago
The only taxonomic category in which microevolution can occur is the ________ level.a. domain.b. species.c. genus.d. kingdom.e.
k0ka [10]

Answer: genus

Explanation:

The answer to the question is genus. The genus is where microevolution occurs or happens. The domain, species, kingdom, family, or population are not the taxonomic category where microevolution occurs. The answer to the question is genus.

Have a nice day!

8 0
3 years ago
Jennifer and Lewis had an argument over the cells they were observing under a microscope. They both agree it is a cell that is g
Anika [276]

Answer:d Explanation:

8 0
2 years ago
Other questions:
  • Which statement describes the photoperiodism of mums?
    12·1 answer
  • The three major clades of bilaterian animals are the __________.
    8·1 answer
  • This macromolecule contains twice as much hydrogen as oxygen
    15·1 answer
  • How do spermatogenesis and oogenesis differ in terms of the number of gametes they produce?
    10·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Identify the wave that has the highest amount of energy​
    10·1 answer
  • Normally, sodium and potassium leakage channels differ because ___________________. multiple choice 1 sodium leakage channels re
    7·1 answer
  • A lake is what type of system? <br>​
    8·2 answers
  • What is the net charge of the structure in the figure below?
    13·1 answer
  • If plaque buildup reduces the radius of the artery by a factor of 2, by what factor does the flow rate change?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!