1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
9

Name two examples of catastrophic events which could lead to a mass extinction?

Biology
1 answer:
Lemur [1.5K]3 years ago
8 0

Asteroid impact

Volcanic eruptions

Explanation:

Asteroid impact and volcanic eruptions are two common events that could lead to a mass extinction.

A mass extinction is an abrupt decrease in life on earth due some catastrophic event.

  • The collision of a large bolide on the surface of the earth is a catastrophe in itself.
  • The collision and its aftermath have destructive consequences on life.
  • The force of the collision can reverberate in form of vibration throughout the earth.
  • It can cause heating of the earth surface.
  • Volcanic eruptions can become global phenomenon that upsets the earth balance.

Learn more:

Extinction brainly.com/question/10860460

#learnwithBrainly

You might be interested in
Changing one base in a gene could have the
saw5 [17]


answer: 2) sequence of building blocks of a protein found in a cell.

Just random FYI:

- it is a mutation, that is generally not looked upon as being severe or detrimental to the person

-by changing the base by either adding or deleting from a protein strand will cause the protein to be useless

-frameshift mutation deals with DNA sequence being shifted. For example: a DNA strand looks like a ladder. If one of the rungs on the ladders gets skipped and the next ladder rung gets the code that the previous rung should have gotten, then that is what a frameshift mutation is. Hopefully that makes sense. It's easier to explain if there was a picture.

there are other types of mutation but I won't get into them.


Hopefully this helped and good luck.

5 0
3 years ago
What path does pollen need to travel for the plant to reproduce?.
FrozenT [24]

Answer:

stigma

Explanation:

Pollination occurs when pollen grains from the anther land on a stigma. After pollen grains land on the stigma, a pollen tube grows from the pollen grain, through the style, and into the ovary. Sperm cells inside the pollen grain travel down the pollen tube and into the ovary which contains the ovules.

6 0
3 years ago
Read 2 more answers
Which forms of transport across a cell membrane do NOT require the use of ATP?
lesya692 [45]

Passive transport is the movement of substances across the membrane without the expenditure of cellular energy.

6 0
3 years ago
Sheep are herbivorous. What can you Infer from this?
valentinak56 [21]

Answer:

Since sheep’s are herbivore, it can be inferenced they only eat plants. Due to the fact they only eat plants, means they are primary animals, and a have lots of predators. They have lots of predators due to the fact they are so low in the food chain, they are right above plants.

7 0
3 years ago
What is cyclic and noncyclic photo-phosphorylation​
nadezda [96]

Explanation:

The photophosphorylation process which results in the movement of the electrons in a cyclic manner for synthesizing ATP molecules is called cyclic photophosphorylation. ... During cyclic photophosphorylation, the electrons are transferred back to P700 instead of moving into the NADP from the electron acceptor.

hope it helps

Mark me as brainliest

if you find helpful

:DD

6 0
3 years ago
Read 2 more answers
Other questions:
  • What occurs when the macromolecule pictured above mixes with water
    14·2 answers
  • The DNA sequence reads acgttcatt before a mutation occurs. After the mutation, the dna senquence reads atcgttcatt. Which type of
    15·1 answer
  • Descreva qual o caminho do impulso nervoso em uma pancada no joelho (dor) e o levantamento da perna
    8·1 answer
  • ______ polymers can be produced in large quantities at low cost.
    11·1 answer
  • 7. Why do scientists think that photosynthetic prokaryotes were probably not the first life forms on Earth?
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Pls help! It’s Due today!!
    11·1 answer
  • List 5 uses for proteins in the cell.
    12·1 answer
  • What are the four criteria for minerals?
    5·1 answer
  • Name three methods of disrupting cells before fractionation
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!