1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveta [45]
3 years ago
15

Phosphorylation cascades involving a series of protein kinases are useful for cellular signal transduction because they _____. p

hosphorylation cascades involving a series of protein kinases are useful for cellular signal transduction because they _____. amplify the original signal many times are species specific counter the harmful effects of phosphatases always lead to the same cellular response use a small and fixed number of molecules
Biology
1 answer:
earnstyle [38]3 years ago
6 0

<span>Ans. They amplify the original signal manyfold.</span>

 Phosphorylation cascade is a series of event in which one enzyme phosphorylate another thereby causing a chain reaction that result into the phosphorylation of thousand proteins. Thus, the enzymes responsible for phosphorylation are known as kinase. Hence, these cascades serve to amplify the original signal and also improving the signal.

You might be interested in
Because it contains just a small amount of distortion over a local area, a _____ projection map is used to make road and weather
yaroslaw [1]
~Hello there!

Your question: <span>Because it contains just a small amount of distortion over a local area, a _____________ projection map is used to make road and weather maps.

Your answer: </span>Because it contains just a small amount of distortion over a local area, a conic  projection map is used to make road and weather maps.

Any queries?

Happy Studying! 
8 0
3 years ago
Read 2 more answers
Why is very little sodium (200 mg) required in the diet for a sedentary individual?
My name is Ann [436]
Because their jobs required them to set all day.
7 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Describe the three types of predation and give an example of each.
uranmaximum [27]
<span>True predation is when a predator kills and eats its prey. Some predators of this type, such as jaguars, kill large prey. They tear it apart and chew it before eating it. Others, like bottlenose dolphins or snakes, may eat their prey whole. In some cases, the prey dies in the mouth or the digestive system of the predator. Baleen whales, for example, eat millions of plankton at once. The prey is digested afterward. True predators may hunt actively for prey, or they may sit and wait for prey to get within striking distance. In grazing , the predator eats part of the prey but does not usually kill it. You may have seen cows grazing on grass. The grass they eat grows back, so there is no real effect on the population. In the ocean, kelp (a type of seaweed) can regrow after being eaten by fish.</span>
3 0
2 years ago
Using the idea of concentration gradient explain why the purple colour of potassium permaganate gradually spreads throughout the
NNADVOKAT [17]

The purple color of potassium permanganate gradually spreads throughout the water in the jar by the process of diffusion.

  • Diffusion is the process of movement of a substance from the region of higher concentration to the regions of lower concentration. Diffusion occurs in liquids as well as gases.
  • Potassium permanganate is a purple color compound, when it is added in a jar of water it spreads throughout the water by the virtue of diffusion.
  • The concentration of potassium permanganate is higher at one point and the other regions in the jar have its nil or low concentrations initially, this leads to the set up of a concentration gradient.
  • As time passes diffusion occurs and the particles of potassium permanganate keep on migrating to the regions of low concentration until the concentration is uniform throughout the jar. Ultimately, it spread throughout the jar making the water purple.

Know more about diffusion

brainly.com/question/14852229

#SPJ4

3 0
2 years ago
Other questions:
  • Summarize how small, nonpolar molecules enter and leave the cell (and why).
    9·1 answer
  • "A technologist in a tissue bank who performed HLA typing by DNA analysis was asked to bank all DNA extracted from specimens rec
    12·1 answer
  • A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 10 million years. Examine th
    10·2 answers
  • Pomeschool GQ
    15·1 answer
  • During which phase of mitosis do the nuclear membrane dissolve
    7·1 answer
  • Which of the following is produced by the reaction shown below.
    6·1 answer
  • B 3.1 Suggest which leaf carries out more photosynthesis and explain why. Below is a section of part of a plant as seen with a l
    13·1 answer
  • Briefly explain what happens during Meosis 1.
    12·1 answer
  • ATP is considered as nature dehydrating agent.what does it means?show with the help of examples
    11·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!