1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zmey [24]
3 years ago
5

8 Describe your favorite science experiment/lab.

Biology
1 answer:
mixas84 [53]3 years ago
6 0

Answer:

No

Explanation:

You might be interested in
Which macromolecules were present in the unknown solution? In the milk?
dexar [7]
Lipids and proteins.

Lipids are macromolecules which provide insulation
. 
A macromolecule is a large molecule. There are four groups of macromolecules: carbohydrates, proteins, nucleic acids and lipids. Lipids consist of glycerol and fatty acids and are constructed from fats, oils, waxes, phospholipids and steroids. A lipid's function is to insulate the body and provide warmth in cold conditions. It can be concluded that a person with very little body fat gets very cold easily and a person with a lot of body fat gets very warm very quickly.

Proteins are biological macromolecule and mostly composed of enzymes.<span> Proteins play a role in the physical make-up of a cell or acts as a cytoskeleton –maintains cell shape and figure. These proteins plays different roles and works with nucleic acids and other macromolecules in the cells including cell cycle, cell adhesion, immune response and cell indicators. <span> </span></span>

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Based on the pedigree chart what should you assume about the parental generation
Angelina_Jolie [31]

<span>B)<span>The mother was a carrier for a sex-linked disease.


</span></span>
5 0
3 years ago
Read 2 more answers
The most frequent type of ground or surface-based temperature inversion is that which is produced by
Romashka [77]
<span>The most frequent type of ground or surface-based temperature inversion is the one produced by terrestrial radiation usually on a clear, still night. Temperature inversion refers to the increase in temperature brought about by the rise in altitude. On the other hand, terrestrial radiation refers to the radiation naturally emitted by radioactive materials present on Earth. Among these are radon, thorium, and uranium. </span>
4 0
3 years ago
Can anyone help me answer #3?
IrinaK [193]
The plant and animals need the nutrients provided in the fats and sugars to live
7 0
3 years ago
Other questions:
  • With their lack of gills, dolphin must surface every 10-15 minutes to breathe using a structure called a blowhole located on the
    5·2 answers
  • The -- states that the cell is the basic unit of a living thing
    15·1 answer
  • Similarity of structures due to common ancestry is called
    10·1 answer
  • What does it mean for a trait to be autosomal?
    8·1 answer
  • When atoms in a covalent bond share electrons unequally (one atoms pulls more than the other), the bond is said to be __________
    11·2 answers
  • The graphic represents the different stages of the cell cycle. Specific genes within the DNA, called inhibitors, stop the cell c
    6·2 answers
  • A life cycle is best described as the...
    11·1 answer
  • The function of the large intestine is to....
    7·1 answer
  • This cockroach is an insect, and the dog is a mammal. Insects and mammals both have structures that support their bodies. What i
    9·1 answer
  • What is The special fluid that helps the bones
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!