1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ch4aika [34]
3 years ago
7

Plz hurry i need these answers fast

Biology
2 answers:
zzz [600]3 years ago
7 0

Answer:

i think it is the population

Explanation:

son4ous [18]3 years ago
3 0

Answer:

i put population

Explanation:

Dependent variable is something that can be measeured you wouldnt measer the days or months first but it makes sence to measure the bird population. (it also says in the title that they are studying the bird population and a word also used for study is measure.)

You might be interested in
FOR CONSTRUCTED RESPONSE QUESTION!
Vlad1618 [11]

The two stages of photosynthesis: Photosynthesis takes place in two stages: light-dependent reactions and the Calvin cycle (light-independent reactions). Light-dependent reactions, which take place in the thylakoid membrane, use light energy to make ATP and NADPH.

4 0
4 years ago
For forensics:<br><br>What are the 4 main types of sand? How are they different?​
soldier1979 [14.2K]

Answer:

molding sand, washed sand, beach sand, mason sand, and silica sand

Explanation:

they all have different features and are better for certain things, for example some of silica sands features are

Molecular Weight: 60.084 g/mol

Exact Mass: 59.966756 g/mol

Boiling Point: 4046°F at 760 mm Hg

Melting Point: 3110°F

8 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What did edison learn from his attempts to see his first patented invention
Simora [160]
This invention was a commercial failure. Edison resolved that in the future he would only invent things that he was certain the public would want. ... This gave Edison the money he needed to set up his first small laboratory and manufacturing facility in Newark, New Jersey in 1871.

found at: https://www.nps.gov/edis/learn/historyculture/edison-biography.htm
8 0
3 years ago
Which represents the cross between two parent plants if one is heterozygous
Alinara [238K]
Yy.yy is your answer ^-^
Hope am right. Good Luck!
8 0
3 years ago
Other questions:
  • If the frequency of homozygous dominant is 60%, the frequency of heterozygous is 20%, and the frequency of homozygous recessive
    11·1 answer
  • A cell spends most of its time in what phase of the cell cycle
    7·2 answers
  • Which term describes the motion of most objects in our solar system
    11·1 answer
  • En que etapa de la meiosis se forma un nuevo nucleo
    7·1 answer
  • In the cell, the source of information about what kind of protein (hormone for
    14·1 answer
  • According to Charles Darwin theory of natural selection
    5·2 answers
  • Disturbances in memory, consciousness, or identity are symptoms of:
    12·2 answers
  • Why do we use models in our everyday lives especially for the weather?
    6·1 answer
  • The part of the blood that carries oxygen is
    11·1 answer
  • What does it mean for an environment to be isotonic?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!