1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
9

By which process are fossil fuels formed?

Biology
2 answers:
TiliK225 [7]3 years ago
8 0

The correct answer is the third one down. Decomposition

LekaFEV [45]3 years ago
7 0
Cellular respiration
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Explain how a forester can make sure that an area is harvested sustainably.
nalin [4]

Answer:

Foresters are responsible for determining areas that can be harvested sustainably and helps monitor areas to be harvested. Foresters determine which areas have trees that can be removed without causing harm to the environment and ensures that areas are not overharvested.

Explanation:

7 0
3 years ago
Do you thing the change in temperature will affect the animals physiology? enzymatic activity
saul85 [17]
Yes, i think the change in temperature will affect the animals phyisiology
7 0
3 years ago
What experimental evidence supports the model of metallic bonding?
Yanka [14]
Metals conduct electricity and heat, indicating that the electrons are free to move. Metals are malleable, showing that atoms are not in fixed positions but can remain bonded even though they change their positions. In metallic bonding, atoms donate electrons to a pool and all the atoms share in the pool. No compounds are formed, but the atoms are bonded into a network.
5 0
3 years ago
Stem cells found in adult tissue, such as in the bone marrow, brain, muscle, skin, and liver, are only capable of .
BigorU [14]
They are capable of renewing and dividing (multiplying) themselves for long periods of time, they are unspecialized, and they can give rise to other specialized cell types. Hope this helps!! :)
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which human activity has had the greatest impact on climate change?
    13·1 answer
  • Quasars are thought to be the centers of distant ____________
    5·1 answer
  • DNA polymerase is an enzyme and “her” job is to_______.
    9·1 answer
  • Animals respond to threats in their environme
    7·1 answer
  • What is the goal of the Psyche mission?
    11·2 answers
  • What is the importance of Geographic Isolation in
    11·1 answer
  • Pls answer real quick!!
    10·1 answer
  • The human eye can detect wavelengths between 400 nm and 700 nm. The sky appears blue (490 nm) due to the scattering of visible l
    14·1 answer
  • A molecule of messenger RNA (mRNA) has just been synthesized in the nucleus of a human cell.
    6·2 answers
  • Genes are specific sections of?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!