1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seraphim [82]
3 years ago
14

Drugs that often lead to the use of other more serious drugs are known as __________ drugs.

Biology
1 answer:
bezimeni [28]3 years ago
4 0
They’re known as gateway drugs.
You might be interested in
What is the proven data called ?
gayaneshka [121]
You're answer my dear person on this website is theory
7 0
3 years ago
Compare and contrast infertility and erectile dysfunction. What are the possible causes and treatments of each?
Korolek [52]

Infertility is the incapacity to conceive an offspring while erectile dysfunction is the incapacity to get aroused so as to engage in sexual intercourse (mostly in men).

Erectile dysfunction could be caused by stress, cardiovascular diseases, and diabetes. Therefore treating it requires maintaining a healthy lifestyle of nutrition and exercise.

Infertility can be caused by disorders of reproductive organs such as endometriosis and occlusion in the tubes. This can be treated by assisted reproduction (IVF), corrective surgery and education.


8 0
4 years ago
Read 2 more answers
Blank have a positive charge and are found in the blank
Inessa05 [86]

Answer:

Protons have a positive charge and are found in the nucleus

Explanation:

5 0
3 years ago
Read 2 more answers
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Explain the role decomposes play in food webs/ food chains
Delvig [45]
Role of decomposer in fooe chain/food web
Decomposers are organisms which convert complex organic molecules into their simple forms.
Example
bacteria, fungi etc.
Explanation
food chain stary from autotrophs and end at decomposers. these organisms are present in soil, rely on dead bodies of plants and animals for their nutrient requirements. These organisms possess strong enzymatic system, which scavenge comples molecules from dead bodies during respiration and convert them into simple nutrients which return back to atmosphere.
4 0
3 years ago
Other questions:
  • Which of the following best describes mollusks? a) They are bilaterally symmetrical and have a soft body sometimes covered with
    15·1 answer
  • : Spot, the giraffe, is not a clone of his father. He inherited DNA from both of his parents. Chromosomes are condensed units of
    12·1 answer
  • Which abiotic factor would likely have the greatest effect on Canadian geese migration?<br />
    5·1 answer
  • How do marine mammals breed?
    11·1 answer
  • A postitivly charged atom has? A.Lost electrons B. Lost protons C.Gained electrons D.Gained protons
    5·1 answer
  • Do baby embryos feel pain while the mother has an abortion?
    12·2 answers
  • 1. In any energy pyramid, only
    8·2 answers
  • Is the biological domain Animalia autotrophic or heterotrophic
    6·1 answer
  • The table below shows the depths at which an index fossil and three other fossils were found.
    6·2 answers
  • Which of the following is a disadvantage of genetic engineering?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!