1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xeze [42]
4 years ago
14

Look at the following energy pyramid. If the producers have 7000 kcal of energy, how much energy will be available for the

Biology
1 answer:
notka56 [123]4 years ago
8 0

Answer: C. 70 Kcal

Hope this helps! :)

You might be interested in
Examining a dolphin _________ highlights its evolutionary history. Early in dolphin development, both fore and hind limb buds fo
Delvig [45]

Answer:

The suitable words for fill in the blanks will be -

  1. embryo
  2. flippers
  3. disappear
  4. off
  5. genetic

Explanation:

Examining a dolphin embryo highlights its evolutionary history. Early in dolphin development, both fore and hind limb buds form. While the forelimb buds continue to develop into flippers, the hind limb buds disappear. The genes that are normally active in the hind limb buds of four-limbed animals are turned off. A genetic change leading to the silencing of a trait during development may have been an important milestone in cetacean evolution.

4 0
3 years ago
Antibiotics which are effective against a variety of microorganisms are called?<br>​
german

Answer: Fungi

Explanation: Antibiotics are chemicals that kill or inhibit the growth of bacteria and are used to treat bacteria infections. They are produced in nature by soil bacteria are fungi.

4 0
4 years ago
Read 2 more answers
How could flying squirrel adapt further to allow it to be more successful?
Otrada [13]

Answer:

The structural adaptations of the flying squirrel has developed a good sense of balance, sail-like fur skin membrane that extends from the wrists to ankles, delicate wrist bones that control this membrane, allowing the squirrel to steer, and a fluffy tail that balances out and stabilizes the flight.

7 0
3 years ago
Which statement best describes the relationship of photosynthesis and energy?
Lunna [17]

Answer:

The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is  stored in the bonds of glucose.

Explanation:

8 0
3 years ago
Which organelles’ function is primarily locomotion
Ahat [919]
I’d say the flagellum. This is a tail-like organisme that helps some cells to move.
6 0
3 years ago
Other questions:
  • In which direction are the periods organized on the periodic table?
    8·1 answer
  • What types of molecules are broken down to make atp?which are most often broken down to make atp?
    7·1 answer
  • Why don’t all molecules contain only single bonds
    9·1 answer
  • Is salt water table salt or sand a substance
    10·1 answer
  • What ocurrs in an updraft
    15·2 answers
  • Que funciones positivas cumplen los animales?
    14·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is the similarity between neural and humoral regulation?​
    8·1 answer
  • Darren is using tongs to carefully lift and move a beaker. What most likely happened before Darren moved the beaker?
    7·1 answer
  • A volcano erupts, harming all the organisms in the area. Eventually, small plants grow but are eventually replaced by larger pla
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!