1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
3 years ago
8

Elephants and rhinos tolerate the small birds that ride their backs and eat insects on their skin. The relationship between the

elephants and the birds is called _____. coevolution mutualism commensalism parasitism
Biology
2 answers:
Oksi-84 [34.3K]3 years ago
8 0
Elephants and rhinos tolerate the small birds the ride their backs and eat insects on their skin. The relationship between the elephants and the birds is called ________.<span>commensalism.</span>
aleksley [76]3 years ago
5 0

The relationship between the elephants and the birds is called commensalism.

Commensalism is a relationship between two organisms of different species in which one organism benefits from the other, and the other is neither harmed nor benefited. This type of relationship usually occur between a larger host, and a smaller commensal (the organism that benefits from the relationship). The commensal can benefit by obtaining nutrients, or shelter from the host organism, which is not affected. From the question given, the small birds obtain their food from the elephants, and the elephants do not benefit, and are not harmed in the relationship. This relationship is an example of commensalism.


You might be interested in
What substances produce carbon dioxide and water and sunlight​
jek_recluse [69]

Answer:

i think glucose and oxygen

Explanation:

7 0
3 years ago
when salt is used to preserve food , the food is___________A . cooled B . coated C.canned Do dehydrated​
mrs_skeptik [129]

Answer:

D-Dehydrated

Explanation:

Salt draws all the water and moisture put of a food making it dehydrated

5 0
3 years ago
Mitochondria and chloroplasts have similarities and differences. All BUT one of the characteristics on the list above are simila
pishuonlain [190]
It's D found in almost all cells
7 0
4 years ago
Read 2 more answers
What is a characteristic of domain archaea?
rewona [7]
One characteristic of domain archaea is their cell walls.
7 0
3 years ago
Why do plants store their food?
Ierofanga [76]

Explanation:

Storing the food helps them to use it in winter and survive because there is very little sunlight available and so they photosynthesis less. When they have extra food they store it in their seeds and when the seed grows it gets it's food from the plant until the plant is able to photosynthesis and produce its food.

7 0
3 years ago
Read 2 more answers
Other questions:
  • The cell transport process that is opposite of the three pictured is called A. endocytosis. B. osmosis. C. exocytosis. D. phagoc
    14·2 answers
  • How has sonography helped advance medical science? by determining the gender of a fetus by viewing organs that could not be seen
    5·2 answers
  • Oscar likes to run at night. even though it is dark, oscar can see because his eyes have specialized cells that convert the low
    5·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • 1. Why is Earth an example of a system?
    5·1 answer
  • Which is the function of the spindle fibers during anaphase of mitosis?
    12·1 answer
  • In which kingdom do all organisms have cells that lack a cell wall?
    13·2 answers
  • Why choose that gene for PCR in the bacterial identification lab?
    8·1 answer
  • The ________ are the primary organs for filtration of the blood.
    14·1 answer
  • What protein plays an important role in determining cell shape by directing cell wall synthesis in non-cocci bacteria?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!