1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
3 years ago
6

Based on electronegativities, which bond of the following bonds is the most polar and which is the least polar? H—F, H—N, H—C, H

—H, and H—O
Biology
1 answer:
almond37 [142]3 years ago
8 0

Answer:

Based on electronegativities H-F bond is most polar and H-H bond is less polar.

Explanation:

Electronegativity  can defined as the ability of an atom to attract the bonding electron pair towards itself.This result in the generation of polarity.

           H-F bond most polar because Fluorine is most electronegative among nitrogen,hydrogen and oxygen.

       On the other hand H-H bond is least polar or nonpolar because the boding electron pair are equally shared by the two hydrogen atoms.

You might be interested in
Electricity flows from?
Blababa [14]

Answer:

Explanation:

Electricity is a flow of tiny particles called electrons which can travel through wires. This flow is often called an 'electric current'. Just like water, which can only flow down a hill, an electric current can only flow if there's something to give it a 'push'.

sorry if im incorrect

7 0
4 years ago
Why does incomplete dominance not support the blending theory of inheritance?
Nookie1986 [14]
Incomplete dominance can happen in flowers such as snap dragons where a red flower plant and a white flower plant have an offspring that is neither red nor white but is a mix so in this case it would be pink. It does not support the blending theory as it does not get its colour from the dominant plant in this case but from both.
5 0
3 years ago
A hypothesis determines ...
statuscvo [17]

Answer:

the correct answer would be C.

Explanation:

it would be C because a hypothesis is your guess of what the results will be. once you test the product you will figure out if your hypotheses was correct or not.

i hope this helps you out!!

-AlphaWolfie-

8 0
3 years ago
Gene expression in eukaryotes can be regulated at various levels. Certain mutations in flies may cause them to develop an extra
vekshin1
Hox genes are also called Homeotic genes.  In which they act as dictators on specific areas of an organism's body on when or where it should be developed. When these genes are overactivated or inactivated it may cause genetic disorders.
3 0
3 years ago
Read 2 more answers
Which feature is forming?
insens350 [35]

Answer:

An island

Explanation:

for me i got it right

8 0
3 years ago
Other questions:
  • Which is not a process involved in the formation of sedimentary rock? depositing cementing eroding cooling
    15·2 answers
  • During protein synthesis , which of the following molecules stay in the nucleus at all times
    10·2 answers
  • Which of the following is the best definition of generation time?
    6·1 answer
  • Which part of the brain looks like a swollen extension of the spinal cord?
    10·1 answer
  • Pelvic bones in whales are an example of ____ structures
    7·2 answers
  • According to this evolutionary tree, the archaea and eukaryotes last shared a common ancestor ________.
    10·2 answers
  • Which of the following is the function of proteins?
    8·2 answers
  • A lack of pigmentation called
    5·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Suppose a fern fossil is found between layer Y and layer z during which time range with fern fossil most likely have formed?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!