1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serggg [28]
3 years ago
12

Carbon fixation occurs during the light reactions.

Biology
2 answers:
lakkis [162]3 years ago
7 0

This would be TRUE!!!!!  

gizmo_the_mogwai [7]3 years ago
4 0
Carbon fixation<span> is the process by which inorganic </span>carbon<span> is added to an organic molecule. </span>Carbon fixation occurs during the light<span> independent </span>reaction<span> of photosynthesis and is the first step in the C3 or Calvin Cycle.</span>
You might be interested in
Which element is necessary to form a protein molecule but not a carbohydrate molecule?
mojhsa [17]

<u>Nitrogen</u> is found in proteins but not in carbohydrates. It is present in all amino acids as it the building block of amino acids.

(by Benjemin)

4 0
3 years ago
Neuropathy of the hypothalamus can cause difficulty in regulating core body temperature so that it fluctuates more widely than e
vaieri [72.5K]

Body maintain Homeostasis by Negative Feedback mechanism. Because the stimuli causing the disturbance in the Homeostasis of the body is to be counteracted by a mechanism.

<h3></h3><h3>What is homeostasis?</h3>

The Homeostasis of the body is defined as the regulation of the internal environment of the body when there is a change.

In Positive feedback mechanism, it increases the response of the stimuli In temperature regulation, the stimuli are hot and cold.

Both are controlled by a opposing negative feedback mechansim that is when the body temeprature increases it is decreased to normal by a negative feedback mechanism , likely when the body temeprature is decreased(cold) , the body will increase the Body temeprature to normal By a Negative feedback mechanism that is exactly opposite(opposing) to the Former Negative feedback mechanism pathway.

In termparature regulation when body temperature raises ----->detected by nerve endings in the skin--Hypothalamus -----> signal to blood vessel for dilation activation of the sweat gland-the tempertaure is maintained to normal. -> signal send to the>heat is lossed and when body temperature decreases -----> detected by nerve endings in the skin------> signal send to the hypothalamus -----> signal to blood vessel for constriction inhibition of secretion from sweat gland, shivering ---->heat is generated -->normal.

For more information regarding hypothalamus, visit:

brainly.com/question/1022285

#SPJ1

 

8 0
3 years ago
What is the goal of meeting economic and human needs? The goal of meeting economic and human needs is improved of life.
Mumz [18]
To keep everyone happy and healthy
8 0
3 years ago
Read 2 more answers
Saltwater fish constantly drink water but still excrete concentrated urine to compensate for the water loss. They also have gill
Dmitrij [34]

Answer:

The above paragraphs describes that how salt- and fresh-water fish regulates their osmoregulation. Hence, the correct answer would be c. have adapted to deal with osmosis.

Osmosis is the process by which solvent's molecule move from region of low concentration (hypo-tonic) to the region of high concentration (hyper-tonic) through a semi-permeable membrane.

In sea-water fishes, the body fluids are hypo-tonic to the surrounding water and thus water is kept moving out of their gills. In order to prevent the excess water loss they need to drink water constantly and excrete concentrated urine.

In contrast, fresh-water fishes body fluids are hyper-tonic to surrounding water and hence, water keeps entering in their body through gills. So, in order to prevent excess dilution they absorb salt from surrounding with the help of gills and also their bodies reabsorb salt from urine.

3 0
4 years ago
Read 2 more answers
The term used to describe a harmless organism resembling a harmful one is _____.
postnew [5]
The correct answer to the question above is Batesian mimicry. The term used to describe a harmless organism resembling a harmful one is called Batesian mimicry. Batesian mimicry is a form of mimicry in which harmless organism had adapted to imitate the predators.
6 0
4 years ago
Other questions:
  • What do you call an animal that eats only meat?
    13·2 answers
  • Which of the following is NOT a typical characteristic of most bacterial plasma membranes?
    10·1 answer
  • What condition is caused by carbon dioxide, methane, and water vapor trapping heat in the Earth's
    6·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which is an organelle that stores the cell’s genetic information? the lysosome the nucleus the mitochondrion the cytoplasm
    8·1 answer
  • Existe relación entre el número de cromosomas y el número de genes en una especie?​
    13·1 answer
  • Even before modern observations provided evidence that supports the Theory of Plate Tectonics, people developed theories that th
    7·2 answers
  • On a map, the continents have shapes that almost fit together like pieces of a jigsaw puzzle. How does modern science explain th
    5·1 answer
  • Which organism is it?
    9·1 answer
  • What nitrogen base in found in RNA but not in DNA?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!