1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler [38]
4 years ago
10

During childbirth, the head of the baby pushes against the mother's cervix. A nerve impulse is transmitted to the brain which ca

uses a release of oxytocin. Oxytocin stimulates uterine contraction and pushes the baby towards the cervix. This process continues until the mother gives birth. This is an example ofa) Positive feedbackb) Negative feedbackc) Reflex feedback
Biology
1 answer:
Bingel [31]4 years ago
3 0

Answer:a positive feedback

Explanation: positive feedback is a type of feedback mechanism employed by the body,in which an output is enhanced or acclerated.

In contrast to negative feedback where the body regulates it's internal conditions by reducing the effect of a stimuli,In positive feedback ,the body enhances the effect of the stimuli.

It is not common as negative feedback in homeostasis.

An example is the increasing release of oxytocin to promote contractions during childbirth,until the child is born.

Another example is the accumulation of blood platelet , in the site of blood vessels injury to

cause blood clotting.

You might be interested in
Pattern of root growth where all branches are about the same size
Len [333]
Fibrous root are a pattern of root growth where all branches are about the same size. A fibrous system is usually formed by thin, moderately branching roots growing from the stem. It is universal in monocotyledonous plants and ferns. Examples of plants that have fibrous root system include; grass, wheat, maize, banana, white clover among others. 
4 0
4 years ago
How could you calculate the speed of a snail or cheetah?
yKpoI14uk [10]

Answer:

you could calculate the speed of a snail or a cheetah by measuring a distance and measuring the time it takes them to get there. direction would be considered if you were finding velocity.

Explanation:

5 0
3 years ago
Nuclear power is an example of an alternative energy source that has greater negative environmental impacts than the buming of f
nordsb [41]

Answer:

i love you

Explanation:

5 0
3 years ago
List three advantages that the ocean provide us with
kondor19780726 [428]

Answer:

Oxygen to us, climate/weather patterns, and provides us with seafood

Explanation:

5 0
4 years ago
Water molecules have a strong attraction to one another.
vampirchik [111]

Answer:

The correct answer is B: Cohesion

Explanation:

<u>Cohesion</u> is the ability of water molecules to be strongly bonded together. This happens due to the polarity of water molecules. Since water is made up of two positive hydrogen ions that combine with one negative oxygen ion to form a hydrogen bond. Hence, the molecular structure of water enables hydrogen irons to attract oxygen ions that create a strong polar bond between water molecules.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which combination of items below is INCORRECT? decomposers – bacteria and fungi pioneer community – lichens and mosses commensal
    9·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Consider how lettuce or spinach placed in water becomes firm and crisp. Use what you have learned about cell membranes to explai
    10·1 answer
  • Genes are ___.
    10·1 answer
  • Describe cloud formation
    8·1 answer
  • 5. Which of the rock samples below is most likely to be a metamorphic rock?
    8·2 answers
  • How does evolution involed?
    11·1 answer
  • From the point of view of your immune system, what is the most likely consequence of picking your nose?
    10·2 answers
  • Can an element be broken down
    6·1 answer
  • What is a phase change that occurs when a gas transition into a liquid?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!