1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
10

How does soil structure affect the characteristic of soil

Biology
2 answers:
natita [175]3 years ago
8 0
The correct answer is C !!

Soil structures like sandy, clay determines the pore space and water content it can have !!
zavuch27 [327]3 years ago
6 0

Answer: Option C

Explanation:

The structure of the soil affects the characteristics of soil because it determines the overall quality of soil. The size and shape of the soil particles provides the structure of the soil.

It influences the growth of the plants growing by affecting the movement of water, nutrients and air to plants.

It also determines the pore space which helps in water percolation and water holding capacity of the cell.

You might be interested in
2.Which of the following is the appropriate time for pruning fruit trees?
Anettt [7]
The answer is c hope that helped
3 0
3 years ago
Read 2 more answers
Scientists can use mutants to study metabolic pathways. These organisms have a mutation in a gene encoding a metabolic pathway e
VashaNatasha [74]

Answer:

jlgd7trus576s6rdyird

Explanation:

3 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
What is the connection between the rising concentration of SO2 And NO2x , And The Acid Rain Pollution Alert?
sweet-ann [11.9K]

Answer:

Acid rain refers to the rain which acidic in nature having a form of precipitation and elevated levels of hydrogen ions (low pH). The normal pH of rain is around 5.6

Rising concentration of Sulfur dioxide (SO2) and nitrogen oxides (NOx) in atmosphere is one of the cause of acid rain. Sulfur dioxide (SO2) and nitrogen oxides (NOx) are released by vehicles, fossil-fuel power plants and oil refineries.

When a sulfur dioxide and nitrogen oxides released in air they mix with oxygen, water and other chemicals in the air and form sulfuric and nitric acids. sulfuric and nitric acids mix with precipitation and its pH level is about 5.2 or below.

Hence, rising concentration of SO2 And NO2x is one of the biggest reason of acid which damages agriculture, buildings and wildlife et-cetra.

5 0
3 years ago
Which of the inner transition metals is critical to the nuclear power industry.
Rom4ik [11]

Answer:

<u>Uranium</u> is the  inner transition metals is critical to the nuclear power industry.

Explanation:

Uranium is a common transition metal found in rocks and is used for nuclear fission reactions. In a nuclear fission reaction, a neutron atom is hit on a uranium atom. As a result, the uranium atoms breaks down releasing huge amounts of energy. Also, more neutrons are released by the breakdown and hence the this neutron hits other uranium atoms and the cycle continues. The most active radioisotope of uranium being used in nuclear fission reactions is U-235.

8 0
3 years ago
Other questions:
  • Transcription and translation worksheet answers
    11·1 answer
  • The spoon is too hot after sitting in the hot soup. is this an example of conduction, convection, or radiation? why?
    12·1 answer
  • Which organelle contains digestive enzymes that break down waste material and debris in the cell? lysosome ribosome vacuole chlo
    7·2 answers
  • What is the consequence of global warming
    12·2 answers
  • The Theory of spontaneous generation was A theory that was supported over time by new facts and data. A theory that was never te
    11·2 answers
  • Griffith's experiments with s. pneumoniae were significant because they showed that traits could be transferred from one organis
    8·1 answer
  • Help plz
    5·2 answers
  • 1 point
    10·1 answer
  • It is the ____________of the folded structure that determines its function. *
    8·1 answer
  • Name two elements that have the same properties as sodium
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!