The first level of his without the first level there would be a second level in the first level is pray and stuff so how is Prague and eat their food for the secondary
The reason people who have AIDS can't fight it off is because it is an immune disease it quickly weakens the immune system and makes a persons body too weak to fight anything off.
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
any of a large group of vertebrate animals that live in water, breathe with gills, and usually have fins and scales
Explanation:
Answer:
The plants would not grow so they have no food
Explanation:
Its cold
