1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
12

Which statement describes potassium-argon dating?

Biology
2 answers:
Dimas [21]3 years ago
5 0

Answer:

A.

Explanation:

did the test

Fiesta28 [93]3 years ago
3 0

Answer: Potassium-40 decays into argon gas over time.

Explanation: Potassium-argon dating is a dating method used to determine the age of sedimentary rocks by comparing the proportion of K-40 to Ar-40 in a sample of rock, and knowing the decay rate of K-40.

Potassium-40 undergoes decay following first order kinetics as given below:

_{19}^{40}\textrm{K}\rightarrow _{18}^{40}\textrm{Ar}+_{0}^1e

You might be interested in
What is the difference between a haploid cell and a diploid cell?
omeli [17]

Answer:

the most most obvious difference between haploid and diploide is

the number of chromosome sets that are found in the nucleus.

Explanation:

haploid cell are those that have only a single set of chromosomes while diploid cells have two sets of chromosomes.

I hope it helps you

6 0
3 years ago
How will you prepare slide without drying quickly
SashulF [63]
Add a few drops of glycerine on the slide,it will prevent the slide from drying.
5 0
3 years ago
Undifferentiated differentiated concentrated or micromarketing which is museums
MA_775_DIABLO [31]
What is the question I’m confused?
4 0
3 years ago
What are the characteristics of the image formed by a plane mirror<br> (any four points)
sattari [20]

Answer:

virtual and erect

behind the mirror

the size of the image is equal to the size of the object

laterally inverted image

Explanation:

3 0
3 years ago
Asbestos is a material that was once used extensively in construction. One risk from working in a building that contains asbesto
natima [27]

Asbestos fiber accumulate in the <em>lysosomes. </em>

Option: (b)

<u>Explanation: </u>

Asbestos is a natural group of minerals and it is composed of thin and needle-like fibers. An asbestos causes several diseases like cancers and so on, including asbestosis and mesothelioma.  

Although asbestos extend and fireproofs materials, this materials are banned in ‘many countries’. But asbestos are not banned in the United States.

Lysosomes are important part of the ‘endomembrane system’ because lysosomes are formed from the ‘endoplasmic reticulum’ and these products are synthesized and processed by the ‘Golgi’.

5 0
4 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • I'm begging please!!!!
    5·2 answers
  • Please need help as soon as possible thank you so much
    7·1 answer
  • When using the higher power objective lenses, you would use this part of the microscope to focus the specimen?
    5·1 answer
  • Covalent bonds can be best described as neutral atoms coming together to share electrons. neutral atoms coming together to creat
    8·2 answers
  • According to cell theory, all new
    14·1 answer
  • How are polysaccharides different from other types of sugars?​
    8·2 answers
  • Name two nutrients that plants need.
    14·2 answers
  • True or false: Due to starvation, amino acids from muscle tissue are converted into glucose. This wastes muscle tissue and can l
    12·1 answer
  • What word means to be passed on from one generation to the next?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!