1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
14

Check all of the following which could describe the first interaction of the acquired immune system to an infection. A. Binding

to IgM B. Activation of complement proteins C. None of the above D. Binding to IgG E. Stimulation of T-cell by APC
Biology
1 answer:
PilotLPTM [1.2K]3 years ago
3 0
<span>E. Stimulation of T-cell by APC</span>

The initial exposure of the body to an infectious agent e.g. through a vaccine, triggers an immune response most of which rapidly diminishes after the vaccination.  However some cells of the immune system called lymphocytes remain with a memory of that pathogen.As a result, if the same pathogen infects a vaccinated person, the memory cells remember and recognize it and rapidly spring into action triggering a much more rapid response specific to that pathogen than the initial exposure, effectively dealing and neutralizing the pathogen.
You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Describe Lynn Margulis' three observations (evidence) which support the endosymbiotic<br> theory.
Helga [31]
There is quite a lot, but the fact that both mitochondria and chloroplasts have their own circular DNAis what I would call "key" evidence. That is, these organelles are not "manufactured" by the cell (i.e., there are no "genes for mitochondria" in eukaryote genomes): like their ancestral bacteria, they reproduce by binary fission.

4




Related questions (More answers below)
4 0
2 years ago
How much of a 100 gram sample of gold-198 is left after 810 days if it’s half life is 2.7
Juliette [100K]

Answer:

mass₁=100.0g

time₁=2.70 days

mass₂=x

time₂=8.10 days

8.10/2.70 = 3

100/2 = 50/2 = 25/2 = 12.5 g

x=12.5 g

7 0
3 years ago
What can dried blood tel an expert?
umka2103 [35]

can you please epxlain your question a litttle better? i can help you?

5 0
3 years ago
Read 2 more answers
Most algae get energy from ____
natali 33 [55]

Some algae have chloroplasts and chlorophyll and obtain their energy through photosynthesis while some algae like euglena are both heterotrophic (decompose dead organic matter) and autotrophic (use photosynthesis) and can also obtain energy likewise.


3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the experimental probability that both recessive genes will be contributed to the child for a specific trait
    12·1 answer
  • How do you figure out the saturation of a substance
    10·1 answer
  • Scientists believe that Earth and the other planets formed _____.
    10·2 answers
  • Is oxygen gas an element or compound
    12·1 answer
  • Index fossils allow us to age rock layers. true false
    13·1 answer
  • Which best describes how fossil fuels form?
    6·1 answer
  • Although a villus, a capillary, and an alveolus are part of different organ systems, they have structural similarities that resu
    5·1 answer
  • To test the responsiveness of the kidneys, scientists have designed an experiment tracking urine output of people during a norma
    9·1 answer
  • When you donate blood, it can be used for blood transfusions. Transfusions are common during certain surgeries or when a person
    15·2 answers
  • Which cellular structure would control the flow of salts into and out of a cell?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!