You can probably find these answers on quizlet
A mammals need for oxygen effects their heart rate because there could be some cases where they're in lack of oxygen causing them to be literally ' out of breath ' . Like climbing a mountain. The higher you go the less oxygen.
Hope I helped !!11!!!!! :)
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
I just answered this same question for my Biology class hope this helps :)
Explanation:
A hydrogen bond is when positive and negative hydrogen forms together; this explains why cohesion sticks molecules together . Because of cohesion, the water molecules stick together and form a surface; this property is responsible for surface tension. Adhesion is the ability for water to stick to other substances; this helps with capillary action. Hydrogen bonding also explains why water's boiling point is higher than some liquid . With this, water has a high specific heat; this is because the water takes a lot of energy to raise (or lower) the temperature. Once again, hydrogen bonding is essential to another property. This property causes water to expand and to have a low density when frozen.
The discovery of that genes can be inserted or tiedinto an other dna molecule using a ligase enzyme