1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
13

What is one effect of immigration on a population living in an ecosystem?

Biology
2 answers:
Novay_Z [31]3 years ago
7 0

Answer:the competition for resources will increase

Explanation:

A pex

sineoko [7]3 years ago
5 0
I believe it’s a) the competition for resources will increase
You might be interested in
Please help answer these
grandymaker [24]
There isn’t a question
8 0
3 years ago
Read 2 more answers
Which particles is the fundamental unit of all matter in both living and nonliving
erica [24]

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

5 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
A _____ is a measure of how much a typical serving size of a particular food raises blood glucose.​
kirill115 [55]
The correct answer is glycemic load.
In particular, glycemic load estimates the amount of carbohydrates in a serving of food and how each gram of these carbohydrates can affect the blood glucose. It is a measure commonly used in weight-loss programmes and in dietary programs used to treat insulin resistance. It has been shown that common spikes of blood glucose and insulin levels, increase the risk for diabetes.
6 0
3 years ago
Read 2 more answers
The histogram shows the worldwide population densities of killer whales, or orcas, distributed by latitude. According to the gra
shutvik [7]

The correct answer is - Most killer whales congregate in the areas that are near the Arctic/Antarctic Circles.

The killer whales have a very large distribution, and they can be found in all oceans, apart from the Southern Ocean. It is noted though that the population density of the killer whales differs from place to place. The higher concentrations are found around the Arctic and Antarctic Circles, where there's cool rich waters, while in the lower latitudes they are much rarer. The reason for this probably lies in the fact that most of the animals that are considered to be the prime food source of the killer whales are living in this rich cold waters.

5 0
3 years ago
Other questions:
  • Explain how deforestion can lead to water pollution.<br>Hello I am new here can help.Thanks​
    13·2 answers
  • What is the bodily purpose of epithelial tissue?
    7·1 answer
  • What is the allele frequency?
    10·2 answers
  • WILL BE BRAINLIEST !!!!!!!!<br><br> Building blocks of proteins are?
    5·2 answers
  • hy was the broad-spectrum revolution a significant event in human evolution? Group of answer choices It brought about a new tool
    14·1 answer
  • You can buy a fish from the pet store
    12·1 answer
  • (a)<br>Name the gas given off in photosynthesis​
    14·2 answers
  • HELP PLEASE WILL GIVE POINTS FOR VOLCANOS DRAG AND DROP USE ATTACHMENT PLEASE
    9·2 answers
  • Describe Claire's symptoms. Explain how they were related to metabolism and homeostasis.
    14·1 answer
  • What organelle processes and sorts proteins to be shipped
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!