Answer:
atoms
Explanation:
all things in the universe are made of atoms and they are considered the fundamental unit of matter.
non-living things are composed of different compounds and molecules.
living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The correct answer is glycemic load.
In particular, glycemic load estimates the amount of carbohydrates in a serving of food and how each gram of these carbohydrates can affect the blood glucose. It is a measure commonly used in weight-loss programmes and in dietary programs used to treat insulin resistance. It has been shown that common spikes of blood glucose and insulin levels, increase the risk for diabetes.
The correct answer is - Most killer whales congregate in the areas that are near the Arctic/Antarctic Circles.
The killer whales have a very large distribution, and they can be found in all oceans, apart from the Southern Ocean. It is noted though that the population density of the killer whales differs from place to place. The higher concentrations are found around the Arctic and Antarctic Circles, where there's cool rich waters, while in the lower latitudes they are much rarer. The reason for this probably lies in the fact that most of the animals that are considered to be the prime food source of the killer whales are living in this rich cold waters.
