1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anarel [89]
3 years ago
15

Describe an experiment you would perform to prove that an orange contains vitamin C

Biology
1 answer:
Tanya [424]3 years ago
5 0
To prove that a certain fruit (in this case, an orange) indeed contains a certain compound (in this case, vitamin C); then the vitamin C should be extracted and isolated from the orange and must be confirmed by molecular analysis. The extraction process involves using chemicals (i.e. 6% MPA), and procedures such as centrifugation and filtration. Then the extract is stored and subjected to high-performance liquid analysis (HPLC) to measure the vitamin C content.
You might be interested in
andy extracted a component of blood and onserved it under the microscope. He found out that the conponent contained cells with n
malfutka [58]

Answer:

WBC.

Explanation:

WBC have cells, hence the name White Blood CELLS. They also contain a nucleus.

3 0
2 years ago
I am going to have to present tomorrow D:. How much phosphorus does sweet corn require per acre?
kaheart [24]

Answer:

Explanation:

                                                                                                                                                                   

7 0
3 years ago
Read 2 more answers
Which organelle acts as the cells command center?
solniwko [45]

Answer:

nucleus

Explanation:

3 0
3 years ago
The magnitude of the voltage induced in a conductor moving through a stationary magnetic field depends on the _______ and the __
Bond [772]
The correct answer is A). Length, Speed.
3 0
4 years ago
Read 2 more answers
What was the experimental variable that Avery used when he repeated Griffith's work?
Leya [2.2K]

Answer:

the type of molecule-destroying enzyme he used

Explanation:

Frederick Griffith and Oswald Avery were scientific researchers who discovered DNA. Frederick Griffith began the research and Oswald Avery continued his research in 1944 when they made the discovery of DNA. When Avery repeated Griffith's research the experimental variable in Avery's experiment was the type of molecule-destroying enzyme he used.

3 0
4 years ago
Other questions:
  • 16. What is the chemical basis of depolarization?
    5·1 answer
  • A. One factor that affects the amount of energy absorbed is the<br> in which a material moves
    15·1 answer
  • The type of reflection in which the light is scattered into many directions is known as
    14·2 answers
  • Hyaline cartilage is composed of a semi solid matrix called ground substance. The major component(s) of ground substance is/are
    8·1 answer
  • What is the immature shoot on a seed called?
    10·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following was NOT a recognized kingdom in Linnaeus' early classification system?
    13·1 answer
  • The job transfer rna is to bring specific amino acids to be added to the peptide chain during protein synthesis which takes palc
    6·1 answer
  • Help!
    7·2 answers
  • What are four things that cause weathering
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!