1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
4 years ago
8

Pleomorphism is best observed with which bacteria?​

Biology
1 answer:
Effectus [21]4 years ago
8 0

Although it has recently been shown that certain bacteria are capable of dramatically changing shape, pleomorphy remains a controversial concept. A well accepted example of pleomorphism is Helicobacter pylori, which exists as both a helix-shaped form (classified as a curved rod) and a coccoid form.

You might be interested in
Which plant structure is the dominant sporophyte of angiosperms?
Elenna [48]
Flowers are the <span>plant structure that is the dominant sporophyte of angiosperms.</span>
5 0
4 years ago
Read 2 more answers
What would you need to do to make the length of your model DNA molecule more accurately represent the length of a real DNA molec
N76 [4]
That sounds like magnification needs to be applied.
Attain the length of a real DNA and then measure the length of your specimen.

Magnification=length of specimen
----------------------------
real length of DNA

7 0
4 years ago
Blood type alleles are a great example of how alleles work together when they don't have a simple dominant/recessive relatio
fenix001 [56]

Answer:

I^A,I^B,and I

Explanation:

The I^A and I^B alleles are co-dominant, and the I allele is recessive.

4 0
3 years ago
A genetically engineered corn plant is approved for agricultural use. The plant produces pollen that can make its own toxins. Th
Yakvenalex [24]

Answer:

The financial costs for the farmer would be lowered.

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following are not biotic or abiotic factors in an ecosystem?
lana [24]
The answer should be D
7 0
3 years ago
Other questions:
  • What is a mushroom niche​
    12·1 answer
  • Which structures are found in all vertebrate? (select 2)
    6·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What is the answer? I’ll give you 10 points
    7·2 answers
  • Can someone please help me please please help me answer this please
    8·1 answer
  • hich of the following is the best explanation of why a second control group was included in this experiment?
    10·2 answers
  • What process is happening in the reaction shown below?
    7·1 answer
  • What of the two listed below are used in the light reactions?
    13·1 answer
  • What do you call that when a pressure ulcer and assign that capillaries in the area have become congested because of impaired bl
    8·1 answer
  • .When this type of volcano erupts, very thin lava flows pour out in all directions from a central vent. What kind of volcano is
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!