1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Illusion [34]
4 years ago
10

Which device measures current by using the reflections of a coil of wire placed in a permanent magnetic field?

Biology
1 answer:
pashok25 [27]4 years ago
5 0

Answer:

a radio uses the reflections of a coil of wire placed in a permanent magnetic field.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
True or False: Homologous structures are structures that are different in related organisms because they were inherited from a c
Afina-wow [57]

Answer:

True

Explanation:

Homologous structures are organs or skeletal elements of animals and organisms that, by virtue of their similarity, suggest their connection to a common ancestor. These structures do not have to look exactly the same, or have the same function

7 0
3 years ago
Unsaturated and saturated lipids exhibit different characteristic based on their structures wich characteristic is unique to sat
xz_007 [3.2K]

Answer:

I believe the answer is C.

Explanation:

Hope my answer has helped you!

6 0
3 years ago
a salmon moves from a saltwater ocean to a freshwater river. What takes place in the salmon's cells as it moves?
Reptile [31]
When the fish is put into fresh water, suddenly the concentration around them is very low and the water potential is extremely high. Water will now move from the relatively high water potential in the water to the relatively low water potential in the cells, the cells start to burst and the fish dies. 
3 0
3 years ago
Read 2 more answers
Explain how fossil evidence and transitional fossils supports the idea that organisms change over time. Choose all that apply.
Ivenika [448]

Answer: all of them

Explanation: I think they’re all true

Hope this helps!

5 0
3 years ago
Read 2 more answers
Other questions:
  • Some beetles and flies have antler-like structures on their heads, much like male deer. The existence of antlers in beetle, fly,
    12·1 answer
  • 1. In your food chain above, explain why there’s an arrow pointing from your decomposer back to the plants.
    7·2 answers
  • What are the differences between sexual and asexual reproduction?
    10·2 answers
  • Allopatric speciation is another name for.. speciation by geographic isolation. speciation due to genetic mutation
    10·1 answer
  • Brown Middle School is trying to become a "green school". To do this, parents, faculty and staff members are meeting to discuss
    9·2 answers
  • Identify the type of joint found between the distal end of the tibia and fibula (distal tibiofibular joint). identify the type o
    13·1 answer
  • List three products of respiration ..
    5·1 answer
  • Black hair is dominant over white hair in rabbits. If a heterozygous, black-
    8·1 answer
  • Which of the following answers would best describe why temperature varies within San Diego County?
    7·1 answer
  • Which of the following would you expect to see in a positive feedback system?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!