1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
4 years ago
10

Which of the following is not a result of olimate change partially caused by burning fossil fuels? a. Leaves changing color in t

he fall months.
Biology
1 answer:
Verdich [7]4 years ago
6 0

Explanation:

An environment's biology includes both abiotic factors like atmosphere, water, soil, sunlight and temperature; and biotic factors which are living components of the ecosystem. These factors lead to a gradual change of an ecosystem over time; however, humans drastically impact the environment through over-exploitation and pollution- we disrupt normal abiotic and biotic interactions. Furthermore, human impact can lead to population die-offs and extinction events, along with food and water scarcity.

Human impact on the environment can manifest as:

  • overpopulation- natural resources are over used, and habitats cannot support human communities;
  • urban communities also expand by cutting down trees in deforestation- this leads to erosion and flooding;
  • burning fossil fuels- this reduces air quality and adds carbon dioxide to the environment leading to global warming;
  • pollution- adding contaminants to the atmosphere, waterways, soil etc.

Leaves change in the fall via a natural process; in green leaves the photosynthetic pigment, Chlorphyll a is produced in significantly lower amounts. Other pigment molecules that absorb and reflect different wavelengths exist in larger concentrations- their effect is more apparent, leading to visibly orange-red leaves.

Learn more about natural disasters at brainly.com/question/1820994

Learn more about ecological succession at brainly.com/question/2456852

#LearnWithBrainly  

You might be interested in
Why do we need antibodies?
Aleonysh [2.5K]
So we can protect ourselves from the same virus if it attacks again in the future
4 0
4 years ago
Read 2 more answers
How have human activities modified ocean systems?
jasenka [17]

Answer:

all of the above.

7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
HELPPPPP WILLL GIVE BRAINLIEST!!!!!RATE!!!!! AND THANKS!!!!! EASY BUT IM DUMB!!!!
Digiron [165]

Answer:

A) organic material in meteorites

Explanation:

8 0
3 years ago
Read 2 more answers
Which of the following statements about bilaterian animals is false?a.All bilaterians have bilateral symmetry.b.Many bilaterians
Bond [772]

Answer:

D.Most bilaterians have tissues but some do not.

Explanation:

7 0
3 years ago
Other questions:
  • Same force on two object of different masses
    15·1 answer
  • Does anyone have a catchy title that relates to the digestive system and stomach cancer?
    8·1 answer
  • Ming’s mother served him fried eggs for breakfast. After seeing the eggs, he noticed that they closely resembled a stage in cell
    8·2 answers
  • Adaptions give organisms a better chance for
    5·1 answer
  • Mitosis is a form of _____ reproduction that produces 2 _____ daughter cells.
    8·2 answers
  • I need an answer ASAP!!
    5·2 answers
  • Black fur(B) in guinea pigs is dominant over white fur(b). Find the probability of a white offspring in a cross between two hete
    15·1 answer
  • dude my friend said he would gimme a dollar if I begged for subs for the brainliest And actually gained a sub.
    14·1 answer
  • Adaptations of a muscle cell to its functions​
    9·1 answer
  • The carrying capacity for a population of squirrels is 620 squirrels, with a maximum rate of increase of 1. 0 per individual per
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!