1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dmitriy555 [2]
3 years ago
9

Which monomer serves as the building block of glycogen, a polymer made up of many glucose molecules? Choose 1 answer: (Choice A)

Amino acid (Choice B) Monosaccharide (Choice C) Nucleotide (Choice D) Steroid
Biology
1 answer:
Licemer1 [7]3 years ago
4 0
Answer is B, monosaccharides
You might be interested in
Light stimuli entering the eye encounter a series of structures while traveling to the brain. Place the structures in the correc
ch4aika [34]

Answer:

The correct answer is "1. cornea 2. retina 3. rods and cones 4. ganglion cells

5. optic nerve 6. thalamus 7. primary visual cortex"

Explanation:

Light must pass a series of structures for the brain being able to interpret the data that comes from the eyes. The order that light stimuli travels from the eye to the brain is as follows:

1. cornea

2. retina

3. rods and cones

4. ganglion cells

5. optic nerve

6. thalamus

7. primary visual cortex

Light enters trough the cornea, the transparent front part of the eye that covers two-thirds of its total optical power; then it goes to the retina which receives the image that could go to the rods or the cones (depending if the light is at low or high levels, respectively). Then, ganglion cells increase the rate of the impulse within the optic nerve, and finally thalamus passes the sensory signal to the primary visual cortex. In this area of the brain, the basic visual features are extracted and interpreted.

6 0
3 years ago
A student wants to buy a new cell phone. Teen Mobile charges $15 a month plus $10 for every one gigabyte of data used. Bruh-rizo
dmitriy555 [2]

Answer:

The unit rate. The gigabyte remains since it's already a unit value "Every one gigabytes." So,

Teen Mobile: $0.5 per day and $10 for every gigabyte. so, y = 0.5x + 10

Bruh-rizon: $1 per day and $7 for every gigabyte. so, y = 1x + 7

Explanation:

Teen Mobile:                                 Bruh-rizon:

x = Monthly                                    y = 30x + 7y

y = each gigabyte

y = 15x + 10y

4 0
3 years ago
Plants have chloroplasts in their cells that give them a green color. What is in a chloroplast that provides the green color?
Cerrena [4.2K]

Plants contain these things called chlorophyll, a green pigment that traps energy from sunlight. It absorbs red and blue light, which gives plants their green color. Hope this helps!

7 0
3 years ago
Read 2 more answers
GIVING BRAINLIEST OUT TO FIRST PERSON TO ANSWER
Vedmedyk [2.9K]

Answer:

C

Explanation:

5 0
3 years ago
Read 2 more answers
What causes tectonic plates to move? -> look at pic pls :)
Nonamiya [84]

Answer:

i think the answer is B i'm not sure though

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Has three stages - evaporation, condensation, and precipitation
    15·1 answer
  • Why would scientists conduct investigations on a newly discovered alternative fuel?
    10·1 answer
  • Explain why living organisms contain more hydrogen atoms than any other atoms, yet 65% of s typical organisms mass in oxygen
    6·1 answer
  • A population has a gene with 2 alleles, G and g. The frequency of the G allele is 0.8. The frequency of the g allele is 0.2. Thi
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How is science different from other subjects that involve thought, such as art, philosophy, and religion?
    8·2 answers
  • Ruben measures the temperature of a beaker of water with a thermometer while his partner, Molly, holds the beaker in her hands.
    11·1 answer
  • In most algae, certain fungi and higher green plant, main components of cell wall is​
    7·1 answer
  • Write the definition for the word Proliferation IN YOUR OWN WORDS.
    13·2 answers
  • Read the passage. Then write a paragraph that explains why the two ecosystems have such different kinds of plants. Use the terms
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!