1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dmitriy555 [2]
3 years ago
9

Which monomer serves as the building block of glycogen, a polymer made up of many glucose molecules? Choose 1 answer: (Choice A)

Amino acid (Choice B) Monosaccharide (Choice C) Nucleotide (Choice D) Steroid
Biology
1 answer:
Licemer1 [7]3 years ago
4 0
Answer is B, monosaccharides
You might be interested in
A microbiologist wants to study the virus particles from a urine sample, but not any bacteria that might be present. How can the
ahrayia [7]
D a chemostat using a low-nutrient medium
8 0
3 years ago
In which direction does dna polymerase make new strand of dna
LenKa [72]

DNA polymerase moves along the old strand in the 3'-5' direction, creating a new strand having the same 5'-3' direction.

8 0
3 years ago
Darby finds a rock in her backyard. It has large crystals. She has found _____.
olga55 [171]
The right answer for the question that is being asked and shown above is that: "-an extrusive igneous rock." Darby finds a rock in her backyard. It has large crystals. She has found <span>-an extrusive igneous rock</span>
4 0
3 years ago
Read 2 more answers
What are some benefits of genetically engi-<br> neered crops?
Stella [2.4K]

Answer:

More nutritious food.

Tastier food.

Disease- and drought-resistant plants that require fewer environmental resources (such as water and fertilizer)

Less use of pesticides.

Increased supply of food with reduced cost and longer shelf life.

Faster growing plants and animals.

Explanation:

Please give me brainliest

5 0
2 years ago
Read 2 more answers
Which of the following species are most likely to be in competition
VLD [36.1K]

Answer:

I would say the answer is B because they're bigger animals.

7 0
2 years ago
Other questions:
  • What limiting factor or factors slowed the growth of the human popualtion on easter island? what other factor might limit the gr
    15·1 answer
  • ______ nations are those who do not have the resources to carry on productive trade agreements.
    8·2 answers
  • Evaporation and transpiration are two processes included in the water cycle. The energy source that drives these processes is
    10·1 answer
  • How does conservation affect biodiversity?
    13·1 answer
  • Which statement about cellulose is true?
    15·2 answers
  • List 3 factors that can speed up the rate of chemical reactions
    7·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which of the following is a negative side effect of burning oil?
    5·1 answer
  • Hunting in the area causes all of the shrews in the area to be
    9·1 answer
  • True or false: the tubuloglomerular feedback mechanism acts as a 'backup' mechanism to the myogenic mechanism in response to inc
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!