Eccentricity of a body following an elliptical orbit defines how nearly circular the path of the object is. When the eccentricity of an orbiting body increases, it means that the body is moving in the most stretched out path.
Answer:
a trait is a characteristic, such as color or size, that is inherited by an offspring from its parents. The genes that control a trait come in pairs, one gene from each parent. If a gene pair contains a dominant allele, then the offspring will show this dominant trait.
step by step:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Which valuable mineral is often found in the rock called kimberlite?<span>A. gold
B. silver
C. diamond
D. platinum
Diamond is one of the most common minerals found in the rock called kimberlite. </span>