1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IceJOKER [234]
3 years ago
5

The Dietary Reference Intake (DRI) for sodium is 1,500 mg daily, however, these recommendations do NOT apply to ____. Group of a

nswer choices lightly active individuals sedentary individuals men and women under the age of 50 highly active individuals who sweat heavily
Biology
1 answer:
monitta3 years ago
5 0

Answer:

highly active individuals who sweat heavily

Explanation:

Dietary Reference Intake (DRI) for sodium is stated at 1,500 mg daily for sedentary individuals, men and women under the age of 50, and is adequate for normal functioning of the body, as too much intake for these categories of people might be unhealthy.  

However, highly active individuals who sweat heavily, such as athletes, would need to consume a higher amount above the recommended 1,500 mg for others.Sodium is required for maintaining fluid balance as muscles and neurons need to be activated by Sodium, which is an electrolyte. Highly active people tend to lose more sodium as they sweat profusely, hence the need for a higher intake of sodium to avoid weakening of the muscles and cramps.

You might be interested in
Which of these organisms can make glucose?
drek231 [11]

Poison Ivy. They are plants and can make their own food aka Glucose.

6 0
3 years ago
Which of the following is true regarding the relationship between ODD and CD? ​ A) CD is almost always preceded by ODD. B) ​Most
creativ13 [48]

Answer:

Option B

Explanation:

ODD means Oppositional Defiant Disorder while CD means Conduct disorder.

Without initial presence of defiant disorder symptoms, Oppositional defiant disorder are not precursor to the development of conduct disorder.

Oppositional Defiant Disorder and Conduct Disorder are much more predominant in boys than in girls.

According to reseaches carried out,to boys, Oppositional Defiant disorder is a precursor to conduct disorder.

6 0
3 years ago
Jordan is asked to draw an image of where he might find igneous rocks. Jordan can figure out where this rock would be found by l
emmasim [6.3K]
I can’t see your answer choices, but igneous rocks are made from cooled lava or magma. This is why these rocks are so brittle and grainy. I’ve attached a helpful image to better explain! Good luck!!!

8 0
2 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
What term is used to describe a planned with a genotype of PP
kozerog [31]
Homozygus- same
the PP are the same allele

The genotype would be 100% homozygus and then whatever the P stands for.

Homozygus P
5 0
3 years ago
Other questions:
  • Why is inter phase important to an organism?
    9·2 answers
  • In a ecological pyramid, what happens to the energy number species as you move up? why?
    6·1 answer
  • In organisms such as plants and mammals DNA is A) an atom
    11·1 answer
  • The three kinds of cells in blood are white blood cells, red blood cells and
    11·2 answers
  • HELP NEED ASAP The parent plant reproduced asexually to form the daughter plant. If the leaf cells of the parent plant have 24 c
    8·1 answer
  • What is gravity and how does it assist in erosion?
    10·1 answer
  • Which of the following is a type of plankton? (1 point)shark algae squid crab
    5·1 answer
  • Tree leaves contain nutrients that are important for trees to grow. When the leaves fall off of the trees, they take those nutri
    11·1 answer
  • NEED IT ASAP!! I WILL MARK A BRAILIEST
    12·1 answer
  • Which of the following describes an independent variable?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!