Poison Ivy. They are plants and can make their own food aka Glucose.
Answer:
Option B
Explanation:
ODD means Oppositional Defiant Disorder while CD means Conduct disorder.
Without initial presence of defiant disorder symptoms, Oppositional defiant disorder are not precursor to the development of conduct disorder.
Oppositional Defiant Disorder and Conduct Disorder are much more predominant in boys than in girls.
According to reseaches carried out,to boys, Oppositional Defiant disorder is a precursor to conduct disorder.
I can’t see your answer choices, but igneous rocks are made from cooled lava or magma. This is why these rocks are so brittle and grainy. I’ve attached a helpful image to better explain! Good luck!!!
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Homozygus- same
the PP are the same allele
The genotype would be 100% homozygus and then whatever the P stands for.
Homozygus P