1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IceJOKER [234]
3 years ago
5

The Dietary Reference Intake (DRI) for sodium is 1,500 mg daily, however, these recommendations do NOT apply to ____. Group of a

nswer choices lightly active individuals sedentary individuals men and women under the age of 50 highly active individuals who sweat heavily
Biology
1 answer:
monitta3 years ago
5 0

Answer:

highly active individuals who sweat heavily

Explanation:

Dietary Reference Intake (DRI) for sodium is stated at 1,500 mg daily for sedentary individuals, men and women under the age of 50, and is adequate for normal functioning of the body, as too much intake for these categories of people might be unhealthy.  

However, highly active individuals who sweat heavily, such as athletes, would need to consume a higher amount above the recommended 1,500 mg for others.Sodium is required for maintaining fluid balance as muscles and neurons need to be activated by Sodium, which is an electrolyte. Highly active people tend to lose more sodium as they sweat profusely, hence the need for a higher intake of sodium to avoid weakening of the muscles and cramps.

You might be interested in
which type of cell division (mitosis v meiosis) increases the likelihood of variation with a species? explain how it happens?
kipiarov [429]
Meiosis Bc it is genetic variation and ends with 4 cells with a completely different genetic make up whole mitosis is the cell division of identical cells. It ends with two daughter cells.
5 0
3 years ago
How one variable affects another happens in:
I am Lyosha [343]

Answer: experiments

Explanation: ap ex certified

4 0
3 years ago
Genotype and phenotype ratio for this cross?<br>​
Lady bird [3.3K]

Answer:

3:1

hope it helps.

<h3>stay safe healthy and happy.</h3>
8 0
3 years ago
Read 2 more answers
What percentage of Bb x Bb offspring will be bb?
Natali [406]
25% of offspring will be bb

8 0
2 years ago
If a mammal did not obtain enough iodine in its diet, you might expect ________.
Natasha_Volkova [10]

Iodine, like all other minerals, is required in considerable quantity in the body. The function of iodine is that it is necessary for proper metabolic function in an animal.

The lack of iodine in a mammal will cripple the physical and metabolic functions and causes developmental delays in the mammal.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Valerie has these signs: extreme fatigue, dizziness, nausea, vomiting, fainting, and a weak, rapid pulse. these are telltale sig
    7·1 answer
  • Which event most accurately describes cytokinesis?
    11·2 answers
  • How many rings does chlorophyll a and b have​
    15·1 answer
  • Biological change over time accounts for the diversity of species. This diversity_____
    5·2 answers
  • Does the nematode have an incomplete digestive system or a complete digestive system? Explain
    8·1 answer
  • What do pioneer species do
    13·1 answer
  • What are some sources of error found in osmosis experiment​
    11·2 answers
  • Please help me im timed and will give brainiest:(​
    5·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!