The one that helps identify leaves as monocot or dicot are the characteristic of their veins. In a monocot, leaves have parallel veins or parallel venation; whereas, dicot leaves have a network of veins or reticulate venation. Hope this is the answer that you are looking for. Have a great day!
Answer:
Explanation:
If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Yes, I believe they are. If you are talking about us humans finding fossils then no. There are many fossils, bones and other interesting things still to be found
