1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
9

Genetically modified food can unexpectedly appear in

Biology
1 answer:
Dafna1 [17]3 years ago
8 0
Do we have any choices? If not i would say that they may be used in feed for animals not genetically modified, causing them to be non-organic. If you grow crops with a GMO fertilizer, it will affect them as well.
You might be interested in
Identify the compound that plants make to store as energy
enyata [817]

Plants store starch which is a complex carbohydrate. This can be broken down into a simple one known as glucose. They then use glucose for energy.

8 0
3 years ago
Read 2 more answers
Which of the following is an organism whose cells each contain a membrane<br> bound nucleus?
DerKrebs [107]

Answer:

D. Eukaryote

Explanation:

An organism that has membrane-bound organelles will have more complex organelles like mitochondria, Golgi apparatus, and ER. These are known as Eukaryotes. Additionally, they will have a nucleus that has the DNA coiled inside. Prokaryotes do not have membrane-bound organelle and the DNA floats in the cytoplasm. Most plants and animals are eukaryotes and all multicellular organisms are too.

3 0
2 years ago
The plasma membrane represents an energetic barrier to the free diffusion of ions from the extracellular space into the cytoplas
Marysya12 [62]

Answer:

Why are molecules such as valinomycin effective at transporting ions across the membrane?

Valinomycin is effective as transporting ions across the membrane because it is no charged, so it can carry ions.

Why would a drop in temperature to or below the transition temperature limit valinomycin mediated K+ transport across the plasma membrane?

Valinomycin is limited by temperature because its activity is highly sensitive and it depends on a stable and an average temperature.

Explanation:

Valinomycin is effective at transporting ion across the membrane because is an antibiotic that alternates hydroxy and amino acid, ans it helps membranes to be permeable. Valinomycin is a cyclic molecule that helps in ions transportation through membranes. Also, antibiotics have a temperature range of activity, that's why it is sensitive to changes.

8 0
2 years ago
What type of material is a lens
guapka [62]
It is mostly glass and fiber glass
5 0
3 years ago
Pure water has a pH of 7. Pure water ______
kykrilka [37]
<span>Pure water has a pH of 7. Pure water is neutral.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a function of protein?
    6·2 answers
  • Explain how drooping of leaves on a hot sunny day is advantageous to a plant
    6·1 answer
  • What are the different types of ecosystems?
    8·1 answer
  • Which adaptation makes bipedalism possible?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • According to modern ideas, the first step in the origin of life was ___________________
    13·1 answer
  • How does temperature change always move from regions of hot to regions of cold?
    8·2 answers
  • Space exploration has advanced our knowledge of the universe. Which space journey would take the longest?
    8·2 answers
  • AMP-PNP is a non-hydrolyzable ATP analog that cannot be metabolized by cells. Taurocholate is a bile acid that helps emulsify fa
    7·1 answer
  • HELP, define genetic engineering and Describe how DNA is modified for use in genetic engineering.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!