1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
docker41 [41]
2 years ago
12

Approximately how much freshwater is easily accessible to humans on earth A. 97% , B. 10% , C. Less than 1%

Biology
2 answers:
xeze [42]2 years ago
8 0

Answer:

Less than 1%

Explanation:

djverab [1.8K]2 years ago
8 0
Answer C. Less than 1%
You might be interested in
Explain how cells in your body benefit from having different systems work together
sasho [114]
Cells in your body work together, they form bones, and muscles. Cells, however cannot work alone, they must be able to work together. Each cell does a different thing.
3 0
2 years ago
Read 2 more answers
Which of the following features did whales possibly inherit from a four-legged ancestor?
pishuonlain [190]

Answer:

2. Hip bones

Explanation:

More than 40 million years ago, whales had ancestors who walked on land. Even now, they have a feature they inherited from them - hip bones. Scientists used to think that they are vestigial, i.e. that they lost their function. However, recently they discovered that these bones help whales (and other marine mammals who have them, such as dolphins) maneuver better mating.

Whales developed the rest of the listed features later, when they became marine animals. This is why they are incorrect.

8 0
2 years ago
A purebred purple flowering plant is crossed with a purebred white flowering plant, and they produce offspring that have purple
IgorLugansk [536]

The answer would be dominant
8 0
3 years ago
Read 2 more answers
(-2-i)(4+1) how do i solve this
Soloha48 [4]
The answer should be —10 — 5i
3 0
2 years ago
Help me with this please!!!!
TiliK225 [7]
I believe it is 2 and 3
8 0
3 years ago
Other questions:
  • Would a mutation in a red blood cell be passed on to offspring? Explain your answer.
    9·1 answer
  • A group of organ systems that work together to perform a common function
    10·1 answer
  • Which of the following best explains why what we know about cells is called a theory and not a law?
    9·2 answers
  • Close observation of the fruiting bodies of cup fungi (ascomycetes) shows that when asci of cup fungi forcibly eject their spore
    11·2 answers
  • 90 points and whoever does it right gets brainliest
    8·2 answers
  • Fill in the blanks with the right group of words.
    11·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 4)A machine can produce 120 candies in
    13·1 answer
  • 2. Sound is like light because<br>​
    10·1 answer
  • why is it important to replicate dna without errors? what might happen if there were errors in dna replication?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!