Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
Answer:
C. Meiosis produces new combinations of chromosomes.
Explanation:
Compared to mitosis, meiosis divides TWICE and has EIGHT stages of rather than mitosis with the regular four stages.
The end result in Meiosis produces haploid cells in which half of the amount of chromosomes are produced in each individual cell, therefore Meiosis produces new combinations of chromosomes.
A. is incorrect because Meiosis does NOT create genetically identical cells.
B. is incorrect because Meiosis creates a HALF set of chromosomes (or just half than the original amount).
D. is incorrect because DNA is not produced during meiosis.
Answer:
Explanation:
The arrangement below is from the smallest to the biggest
nucleotide → nucleus DNA → gene → chromosome → cell
The nucleotide is the smallest because it is what makes up the DNA, it is made up of a nitrogenous base, ribose sugar and a phosphate group.
Nucleus DNA follows because it is bigger than a nucleotide (as said earlier) but is singly found in the chromosome which is present in the nucleus.
The gene, which can be assumed to be the entire genome of the organism, involves both the chromosomal gene and the extrachromosomal gene (like the mitochondrial DNA).
Chromosome is made up of a DNA molecule and protein which makes it bigger than the Nucleus DNA and the gene because it contains several genes.
The Cell contains all the molecules/organelles mentioned above and as such is the largest among them all.
Note that the spellings the question are wrong and have been corrected in the answers provided
3. The heat makes your sweat glands open faster
