1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
3 years ago
14

Benthic organisms may be found

Biology
1 answer:
krok68 [10]3 years ago
4 0
Benthic Organisms may be found B.) LIVING ON THE BOTTOM OF A BODY OF WATER.

Benthic organisms are called Benthos. They live in and on the ocean floor. Examples of these organisms are worms, clams, lobsters, crabs, and sponges.

Benthos are classified as filter feeders or deposit feeders.
You might be interested in
As liquid water becomes ice, the space between water molecules increases. Which property of water does this change describe?
SCORPION-xisa [38]

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen.

7 0
3 years ago
Read 2 more answers
Mean arterial pressure is closer to systolic blood pressure than diastolic blood pressure Mean arterial pressure is closer to sy
Ganezh [65]

Answer:

False

Explanation:

Mean arterial pressure is obtained by the following equation: (Systolic BP + Diastolic BP + Diastolic BP) / 3.

For example, the mean arterial pressure (MAP) of normal blood pressure in human beings (that is, 120/80 mmHg) would be:

(Systolic BP + Diastolic BP + Diastolic BP) / 3

120 + 80 + 80 / 3

280 / 3

93.3

This is why MAP is closer to diastolic BP than systolic BP.

5 0
4 years ago
How long does a two toed Salamander live
erma4kov [3.2K]
Salamanders are preyed upon by garter snakes, small mammals, birds, and fish. An adult may live 6–10 years, with the largest individuals weighing approximately 7.5 grams (0.26 oz), snout to vent lengths reaching 8 cm (3.1 in), and total lengths reaching 14 cm (5.5 in).
3 0
3 years ago
What replaced the animal drawn farm implements​
valina [46]

Answer:

Cultivator.

Explanation:

Instruments such as cultivator replaced the animal drawn farm implements​ because these instruments works quickly and more efficiently. This cultivator has long teeth which soften the soil for better root penetration and aeration of the soil. This instrument works with high speed and finished its work in hours not days which make it more preferable in agriculture than animals.

8 0
3 years ago
2 Points
Mumz [18]

Answer:

The correct answer is A. An ionic compound

Explanation:

Sodium (metal) and chlorine (nonmetal) form an ionic bond to each other, forming the NaCl (sodium chloride) molecule. Sodium transfers an electron to chlorine, which is missing an electron to complete the octet rule.

8 0
3 years ago
Other questions:
  • Arrange the cells in order from least specialized to most specialized. Cells of the mesoderm cells of a zygote cells of a blasto
    9·1 answer
  • Which of the following is widely regarded as the most significant, insightful, and powerful type of information that science gen
    11·1 answer
  • In today’s pattern of extinction, the generation of new species is unlikely because _____.
    6·1 answer
  • Describe how teens can learn positive behavior...HELP ASAP!!!!
    8·2 answers
  • Excess hydrogen ion is eliminated from the body largely by
    11·1 answer
  • A new patient visits the internal medicine clinic today for diabetes, chronic constipation, arthritisand a history of cardiac di
    8·2 answers
  • What is the function of the telomere?
    8·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • What is a molecule in your own words?
    7·1 answer
  • Why human with heterozygous genotype will have the dominant phenotype?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!