1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kow [346]
3 years ago
13

Cottonwood, aspen, and willow trees have beige flowers, with no petals, that appear before the tree's leaves are out in the spri

ng; and they are dioecious. What does this indicate about these trees
Biology
1 answer:
Luden [163]3 years ago
4 0

Answer: Their pollen is dispersed by wind.

Explanation:

You might be interested in
Explain why an egg is considered to be unicelular.
Delicious77 [7]

Answer:

membrane and everything else inside is considered the cell, it can be said that it is a single cell. Then, the chicken egg deserves its reputation as the largest cell. If, however you consider the yolk and the albumen (the egg white), separate structures, then eggs are not a single cell.

Explanation:

Short answer: One ovum = one cell = single cell (Latin: unam cellulam), from which we get uni-cellular. ... The zygote resulting from a successful fertilization of a single egg cell (a living unicellular organism), by a single sperm cell (also a living unicellular organism), is also a living unicellular organism

3 0
3 years ago
An organism that has different alleles - one dominate and one recessive it's called<br>​
Zigmanuir [339]

Answer:

An organism which has two different alleles of the gene is called heterozygous. Phenotypes (the expressed characteristics) associated with a certain allele can sometimes be dominant or recessive, but often they are neither.

Explanation:

7 0
3 years ago
A scientist observed that during the course of a chemical reaction number of ATP molecules was reduced what did the scientist mo
AleksandrR [38]
<span>The reaction required an input of energy.</span>
3 0
3 years ago
Read 2 more answers
Why are amino acids called amino acids?
S_A_V [24]
B. they are single molecules...
7 0
3 years ago
Clear access routes into and out of chemical zones used to avoid contamination are called
sp2606 [1]
Access Control Points

They are restrictions points that enforce regulations and guidelines on decontamination when exiting the sites and ensuring adherence safety standards when entering the site. The regulation are usually, as standard practice, conspicuously posted at the Access Control Points.
Access Control Points are usually set up at the periphery of the Exclusion Zones, and ideally, there should be a separate entrance and exit Control Access Point.
7 0
3 years ago
Other questions:
  • Which cellular organelles is responsible for modifying,sorting,and packaging proteins and lipids
    15·1 answer
  • Wolves feed on a variety of large prey, including elk. Elk feed on shrubs and trees like aspen and cottonwood trees.
    10·2 answers
  • Which best describes the relationship between evolution and natural selection?
    6·2 answers
  • A spit is deformed through wave deposition
    8·1 answer
  • Why there is uncertainty in science.
    13·1 answer
  • CLICK HERE PLEASE HELP
    5·2 answers
  • Scientists cannot use the scientific method to reproduce another scientists experiment True or False
    8·1 answer
  • Mass measures the amount of ______ in a substance
    15·1 answer
  • In a salt solution ,salt is to,___while water is ____
    11·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!