Volcanoes form at different plate boundaries because of the plates divergent and convergent nature. the plates are always in motion, however minimal they may be. When the plates move apart from each other, the magma from below comes up to fill in the vacant space and thus a volcano is formed. It may be the other way round also and that is the magma forces the plates to move away and this results in the formation of a volcano. When one of plates dives under another plate, then the pressure creates melting of the mantle and thereby forms magma which in turn creates volcanoes.
The correct answer of the given question above would be ROBERT HOOKE. It was Robert Hooke, who coined the term "cell" in reference to the tiny structures seen in living organisms. His book "Micrographia" is the most important achievement that he has.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Diploid saprophytic generation with haploid gametophytic generation
Answer:
D
Explanation:
d because since both bears mated, there is a chance of evolution from there genes