1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

Which substance is considered a building block for all living things?

Biology
1 answer:
s2008m [1.1K]3 years ago
8 0

Answer:

Cells

Explanation:

all living things are made up of one or more cells

You might be interested in
The action that moves the scapula towards the head is called __________. the action that moves the scapula towards the head is c
ozzi
Elevation is the answer
6 0
3 years ago
Which of the following conclusions can be made based on the observed fact that stem cells can differentiate into any kind of cel
Hatshy [7]

Answer:

a

Explanation:

7 0
3 years ago
Which of the following describes the difference between nitrogen-14 and nitrogen-15? ( point)
AveGali [126]

Answer:

D. Nitrogen-14 has 7 electrons, 7 protons, 7 neutrons nitrogen-15 has 7 electrons, 7 protons, and 8 neutrons

Explanation:

In an atom, number of electrons is equal to the number of protons.  And the number of neutrons is equal to the difference between the mass number of the atom and the atomic number. For Nitrogen 14, electron is 7, proton is also 7 as number  of electrons and number of protons are equal. So, the neutron will be 14-7= 7. For Nitrogen 15, electron number is 7 so proton number will be also 7. Neutron number for nitrogen 15 will be 15-7= 8. That's why the answer is option number 4.

8 0
3 years ago
How does an enzyme inhibitor work ?
Georgia [21]
An enzyme inhibitor works as a combination in order to slow down the rate of an enzyme-catalyzed reaction. In order for an enzyme inhibitor to do this, it impacts the of "S" and/or the turn over number. An enzyme inhibitor can also be organic or inorganic and can be found in drugs or antibiotics. 
5 0
3 years ago
According to the food web shown below, the mushrooms would be classified as A. consumers. B. decomposers. C. producers. D. herbi
vaieri [72.5K]

Answer:

is there a pic or anything that goes with the question?

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • 45. Which is created by transgenic organisms and utilized by humans?
    6·1 answer
  • Name the common parasitic fungi in people.
    9·1 answer
  • How is DNA fragment length measured?
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • By the year 2030 is estimated that nearly one in______Americans will be older than her age 65
    6·2 answers
  • Cell phones use radio waves for communications. What layer of the atmosphere aids in reflecting the radio waves?
    15·2 answers
  • A student is constructing an explanation of the cycling of matter in and out of a plant during photosynthesis. Which statement w
    9·2 answers
  • Population pyramids tell information about the population of a location, giving information on age
    7·1 answer
  • Before a plant grown in a greenhouse can be planted in a field or garden, it should first be ______off.
    11·1 answer
  • Outcome of pancreaticoduodenectomy with pylorus preservation or with antrectomy in the treatment of chronic pancreatitis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!